From 4abcce013c9ee3053badf2abda77190233066676 Mon Sep 17 00:00:00 2001 From: Mitja Felicijan Date: Fri, 23 Feb 2024 10:35:22 +0100 Subject: Testing thoughts page --- ...22-07-05-what-would-dna-sound-if-synthesized.md | 365 --------------------- 1 file changed, 365 deletions(-) delete mode 100644 _posts/2022-07-05-what-would-dna-sound-if-synthesized.md (limited to '_posts/2022-07-05-what-would-dna-sound-if-synthesized.md') diff --git a/_posts/2022-07-05-what-would-dna-sound-if-synthesized.md b/_posts/2022-07-05-what-would-dna-sound-if-synthesized.md deleted file mode 100644 index 6efe559..0000000 --- a/_posts/2022-07-05-what-would-dna-sound-if-synthesized.md +++ /dev/null @@ -1,365 +0,0 @@ ---- -title: What would DNA sound if synthesized to an audio file -permalink: /what-would-dna-sound-if-synthesized.html -date: 2022-07-05T12:00:00+02:00 -layout: post -type: post -draft: false ---- - -## Introduction - -Lately, I have been thinking a lot about the nature of life, what are the -foundation blocks of life and things like that. It's remarkable how complex and -on the other hand simple the creation is when you look at it. The miracle of -life keeps us grounded when our imagination goes wild. If the DNA are the blocks -of life, you could consider them to be an API nature provided us to better -understand all of this chaos masquerading as order. - -I have been reading a lot about superintelligence and our somehow misguided path -to create general artificial intelligence. What would the building blocks or our -creation look like? Is the compression really the ultimate storage of -information? Will our creation also ponder this questions when creating new -worlds for themselves, or will we just disappear into the vastness of -possibilities? It is a little offensive that we are playing God whilst being -completely ignorant of our own reality. Who knows! Like many other -breakthroughs, this one will also come at a cost not known to us when it finally -happens. - -To keep things a bit lighter, I decided to convert some popular DNA sequences -into an audio files for us to listen to. I am not the first one, nor I will be -the last one to do this. But it is an interesting exercise in better -understanding the relationship between art and science. Maybe listening to DNA -instead of parsing it will find a way into better understanding, or at least -enjoying the creation and cryptic nature of life. - -## DNA encoding and primer example - -I have been exploring DNA in the past in my post from about 3 years ago in -[Encoding binary data into DNA -sequence](/encoding-binary-data-into-dna-sequence.html) where I have been -converting all sorts of data into DNA sequences. - -This will be a similar exercise but instead of converting to DNA, I will be -generating tones from Nucleotides. - -| Nucleotides | Note | Frequency | -| ---------------- | ---- | --------- | -| **A** (Adenine) | A | 440 Hz | -| **C** (Cytosine) | C | 783.99 Hz | -| **G** (Guanine) | G | 523.25 Hz | -| **T** (Thymine) | D | 587.33 Hz | - -Since we do not have T in equal-tempered scale, I choose D to represent T note. - -You can check [Frequencies for equal-tempered scale, A4 = 440 -Hz](https://pages.mtu.edu/~suits/notefreqs.html). For this tuning, we also -choose `Speed of Sound = 345 m/s = 1130 ft/s = 770 miles/hr`. - -Now that we have this out of the way, we can also brush up on the DNA sequencing -a bit. This is a famous quote I also used for the encoding tests, and it goes -like this. - -> How wonderful that we have met with a paradox. Now we have some hope of -> making progress. -> ― Niels Bohr - -```shell ->SEQ1 -GACAGCTTGTGTACAAGTGTGCTTGCTCGCGAGCGGGTACGCGCGTGGGCTAACAAGTGA -GCCAGCAGGTGAACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGCTGGCGGGTGA -ACAAGTGTGCCGGTGAGCCAACAAGCAGACAAGTAAGCAGGTACGCAGGCGAGCTTGTCA -ACTCACAAGATCGCTTGTGTACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGTAT -GCTTGCTGGCGGACAAGCCAGCTTGTAAGCGGACAAGCTTGCGCACAAGCTGGCAGGCCT -GCCGGCTCGCGTACAAATTCACAAGTAAGTACGCTTGCGTGTACGCGGGTATGTATACTC -AACCTCACCAAACGGGACAAGATCGCCGGCGGGCTAGTATACAAGAACGCTTGCCAGTAC -AACC -``` - -This is what we gonna work with to get things rolling forward, when creating -parser and waveform generator. - -## Parsing DNA data - -This step is rather simple one. All we need to do is parse input DNA sequence in -[FASTA format](https://en.wikipedia.org/wiki/FASTA_format) well known in -[Bioinformatics](https://en.wikipedia.org/wiki/Bioinformatics) to extract single -Nucleotides that will be converted into separate tones based on equal-tempered -scale explained above. - -```python -nucleotide_tone_map = { - 'A': 440, - 'C': 523.25, - 'G': 783.99, - 'T': 587.33, # converted to D -} - -def split(word): - return [char for char in word] - -def generate_from_dna_sequence(sequence): - for nucleotide in split(sequence): - print(nucleotide, nucleotide_tone_map[nucleotide]) -``` - -## Generating sine wave - -Because we are essentially creating a long stream of notes we will be appending -sine notes to a global array we will later use for creating a WAV file out of -it. - -```python -import math - -def append_sinewave(freq=440.0, duration_milliseconds=500, volume=1.0): - global audio - - num_samples = duration_milliseconds * (sample_rate / 1000.0) - - for x in range(int(num_samples)): - audio.append(volume * math.sin(2 * math.pi * freq * (x / sample_rate))) - - return -``` - -The sine wave generated here is the standard beep. If you want something more -aggressive, you could try a square or saw tooth waveform. - -## Generating a WAV file from accumulated sine waves - - -```python -import wave -import struct - -def save_wav(file_name): - wav_file = wave.open(file_name, 'w') - nchannels = 1 - sampwidth = 2 - - nframes = len(audio) - comptype = 'NONE' - compname = 'not compressed' - wav_file.setparams((nchannels, sampwidth, sample_rate, nframes, comptype, compname)) - - for sample in audio: - wav_file.writeframes(struct.pack('h', int(sample * 32767.0))) - - wav_file.close() -``` - -44100 is the industry standard sample rate - CD quality. If you need to save on -file size, you can adjust it downwards. The standard for low quality is, 8000 or -8kHz. - -WAV files here are using short, 16 bit, signed integers for the sample size. -So, we multiply the floating-point data we have by 32767, the maximum value for -a short integer. - -> It is theoretically possible to use the floating point -1.0 to 1.0 data -> directly in a WAV file, but not obvious how to do that using the wave module -> in Python. - -## Generating Spectograms - -I have tried two methods of doing this and both were just fine. I however opted -out to use the [SoX - Sound eXchange, the Swiss Army knife of audio -manipulation](https://linux.die.net/man/1/sox) one because it didn't require -anything else. - -```shell -sox output.wav -n spectrogram -o spectrogram.png -``` - -An example spectrogram of Ludwig van Beethoven Symphony No. 6 First movement. - - - -![Ludwig van Beethoven Symphony No. 6 First movement](/assets/posts/dna-synthesized/symphony-no6-1st-movement.png){:loading="lazy"} - -The other option could also be in combination with -[gnuplot](http://www.gnuplot.info/). This would require an intermediary step, -however. - -```shell -sox output.wav audio.dat -tail -n+3 audio.dat > audio_only.dat -gnuplot audio.gpi -``` - -And input file `audio.gpi` that would be passed to gnuplot looks something like -this. - -```txt -# set output format and size -set term png size 1000,280 - -# set output file -set output "audio.png" - -# set y range -set yr [-1:1] - -# we want just the data -unset key -unset tics -unset border -set lmargin 0 -set rmargin 0 -set tmargin 0 -set bmargin 0 - -# draw rectangle to change background color -set obj 1 rectangle behind from screen 0,0 to screen 1,1 -set obj 1 fillstyle solid 1.0 fillcolor rgbcolor "#ffffff" - -# draw data with foreground color -plot "audio_only.dat" with lines lt rgb 'red' -``` - -## Pre-generated sequences - -What I did was take interesting parts from an animal's genome and feed it to a -tone generator script. This then generated a WAV file and I converted those to -MP3, so they can be played in a browser. The last step was creating a -spectrogram based on a WAV file. - -### Niels Bohr quote - - - -![Spectogram](/assets/posts/dna-synthesized/quote/spectogram.png){:loading="lazy"} - -### Mouse - -This is part of a mouse genome `Mus_musculus.GRCm39.dna.nonchromosomal`. You -can get [genom data -here](http://ftp.ensembl.org/pub/release-106/fasta/mus_musculus/dna/). - - - -![Spectogram](/assets/posts/dna-synthesized/mouse/spectogram.png){:loading="lazy"} - -### Bison - -This is part of a bison genome `Bison_bison_bison.Bison_UMD1.0.cdna`. You can -get [genom data -here](http://ftp.ensembl.org/pub/release-106/fasta/bison_bison_bison/cdna/). - - - -![Spectogram](/assets/posts/dna-synthesized/bison/spectogram.png){:loading="lazy"} - -### Taurus - -This is part of a taurus genome `Bos_taurus.ARS-UCD1.2.cdna`. You can get -[genom data -here](http://ftp.ensembl.org/pub/release-106/fasta/bos_taurus/cdna/). - - - -![Spectogram](/assets/posts/dna-synthesized/taurus/spectogram.png){:loading="lazy"} - -## Making a drummer out of a DNA sequence - -To make things even more interesting, I decided to send this data via MIDI to my -[Elektron Model:Samples](https://www.elektron.se/en/model-samples). This is a -really cool piece of equipment that supports MIDI in via USB and 3.5 mm audio -jack. - -Elektron is connected to my MacBook via USB cable and audio out is patched to a -Sony Bluetooth speaker I have that supports 3.5 mm audio in. Elektron doesn't -have internal speakers. - -![](/assets/posts/dna-synthesized/elektron/IMG_0619.jpg){:loading="lazy"} - -![](/assets/posts/dna-synthesized/elektron/IMG_0620.jpg){:loading="lazy"} - -![](/assets/posts/dna-synthesized/elektron/IMG_0622.jpg){:loading="lazy"} - -For communicating with Elektron, I choose `pygame` Python module that has MIDI -built in. With this, it was rather simple to send notes to the device. All I did -was map MIDI notes to the actual Nucleotides. - -Before all of this I also checked Audio MIDI Setup app under MacOS and checked -MIDI Studio by pressing ⌘-2. - -![](/assets/posts/dna-synthesized/elektron/midi-studio.jpg){:loading="lazy"} - -The whole script that parses and send notes to the Elektron looks like this. - -```python -import pygame.midi -import time - -pygame.midi.init() - -print(pygame.midi.get_default_output_id()) -print(pygame.midi.get_device_info(0)) - -player = pygame.midi.Output(1) -player.set_instrument(2) - -def send_note(note, velocity): - global player - player.note_on(note, velocity) - time.sleep(0.3) - player.note_off(note, velocity) - - -nucleotide_midi_map = { - 'A': 60, - 'C': 90, - 'G': 160, - 'T': 180, # is D -} - -with open("quote.fa") as f: - sequence = f.read().replace('\n', '') - -for nucleotide in [char for char in sequence]: - print("Playing nucleotide {} with MIDI note {}".format( - nucleotide, nucleotide_midi_map[nucleotide])) - send_note(nucleotide_midi_map[nucleotide], 127) - -del player -pygame.midi.quit() -``` - - - -All of this could be made much more interesting if I choose different -instruments for different Nucleotides, or doing more funky stuff with Elektron. -But for now, this should be enough. It is just a proof of concept. Something to -play around with. - -## Going even further - -As you probably notice, the end results are quite similar to each other. This is -to be expected because we are operating only with 4 notes essentially. What -could make this more interesting is using something like -[Supercollider](https://supercollider.github.io/) to create more interesting -sounds. By transposing notes or using effects based on repeated data in a -sequence. Possibilities are endless. - -It is really astonishing what can be achieved with a little bit of code and an -idea. I could see this becoming an interesting background soundscape instrument -if done properly. It could replace random note generator with something more -intriguing, biological, natural. - -I actually find the results fascinating. I took some time and listened to this -music of nature. Even though it's quite the same, it's also quite different. -The subtle differences on repeat kind of creates music on its own. Makes you -wonder. It kind of puts Occam’s Razor in its place. Nature for sure loves to -make things as energy efficient as possible. -- cgit v1.2.3