From 9f5454bda6299db43a4e9de5b3716471388b81d9 Mon Sep 17 00:00:00 2001 From: Mitja Felicijan Date: Sat, 27 Aug 2022 14:05:48 +0200 Subject: Move blog to Hugo --- assets/algae-sava/dji-algae-0.jpg | Bin 145615 -> 0 bytes assets/algae-sava/dji-algae-1.jpg | Bin 154416 -> 0 bytes assets/algae-sava/dji-algae-2.jpg | Bin 114347 -> 0 bytes assets/algae-sava/dji-algae-3.jpg | Bin 128019 -> 0 bytes assets/algae-sava/dji-algae-4.jpg | Bin 217747 -> 0 bytes assets/algae-sava/dji-algae-5.jpg | Bin 264884 -> 0 bytes assets/cv/avatar.gif | Bin 2174 -> 0 bytes assets/dfd-rice/desktop.png | Bin 329498 -> 0 bytes assets/dfd-rice/install-00.png | Bin 35695 -> 0 bytes assets/dfd-rice/install-01.png | Bin 28042 -> 0 bytes assets/dfd-rice/install-02.png | Bin 21638 -> 0 bytes assets/dfd-rice/install-03.png | Bin 34698 -> 0 bytes assets/dfd-rice/install-04.png | Bin 28346 -> 0 bytes assets/dfd-rice/install-05.png | Bin 13755 -> 0 bytes assets/dfd-rice/installation.svg | 1554 -------------------- assets/dfd-rice/layout.png | Bin 9072 -> 0 bytes assets/dfd-rice/layout.svg | 132 -- assets/dfd-rice/script.png | Bin 65747 -> 0 bytes assets/dna-sequence/benchmarks.ods | Bin 21911 -> 0 bytes assets/dna-sequence/chart-encoding-speed.png | Bin 14201 -> 0 bytes assets/dna-sequence/chart-file-sizes.png | Bin 12391 -> 0 bytes assets/dna-sequence/dna-basics.jpg | Bin 165883 -> 0 bytes assets/dna-sequence/quote.png | Bin 1068 -> 0 bytes assets/dna-sequence/sample-binary-file.png | Bin 66417 -> 0 bytes assets/dna-sequence/sample.png | Bin 65930 -> 0 bytes assets/dna-synthesized/bison/in.txt | 11 - assets/dna-synthesized/bison/out.mp3 | Bin 960469 -> 0 bytes assets/dna-synthesized/bison/spectogram.png | Bin 52808 -> 0 bytes assets/dna-synthesized/elektron/IMG_0619.jpg | Bin 226025 -> 0 bytes assets/dna-synthesized/elektron/IMG_0620.jpg | Bin 242937 -> 0 bytes assets/dna-synthesized/elektron/IMG_0622.jpg | Bin 279234 -> 0 bytes assets/dna-synthesized/elektron/elektron.mp4 | Bin 22478213 -> 0 bytes assets/dna-synthesized/elektron/midi-studio.jpg | Bin 63633 -> 0 bytes assets/dna-synthesized/mouse/in.txt | 9 - assets/dna-synthesized/mouse/out.mp3 | Bin 864547 -> 0 bytes assets/dna-synthesized/mouse/spectogram.png | Bin 114261 -> 0 bytes assets/dna-synthesized/quote/in.txt | 8 - assets/dna-synthesized/quote/out.mp3 | Bin 678973 -> 0 bytes assets/dna-synthesized/quote/spectogram.png | Bin 108863 -> 0 bytes .../dna-synthesized/symphony-no6-1st-movement.mp3 | Bin 11650187 -> 0 bytes .../dna-synthesized/symphony-no6-1st-movement.png | Bin 245694 -> 0 bytes assets/dna-synthesized/taurus/in.txt | 11 - assets/dna-synthesized/taurus/out.mp3 | Bin 1056599 -> 0 bytes assets/dna-synthesized/taurus/spectogram.png | Bin 109064 -> 0 bytes assets/do-fuse/copy-benchmarks.tsv | 101 -- assets/do-fuse/fuse-droplets.png | Bin 42891 -> 0 bytes assets/do-fuse/fuse-spaces.png | Bin 32450 -> 0 bytes assets/do-fuse/sqlite-benchmarks.tsv | 1001 ------------- assets/dropbox-sync/dropbox-spaces.png | Bin 47661 -> 0 bytes assets/esp8366-micropython/boards.jpg | Bin 98162 -> 0 bytes assets/general/alert-dark.svg | 99 -- assets/general/alert-light.svg | 99 -- assets/general/elasticlunr.min.js | 10 - assets/general/favicon.ico | Bin 15406 -> 0 bytes assets/general/favicon.png | Bin 4771 -> 0 bytes assets/go-profiling/golang-profiling-cpu.pdf | Bin 16518 -> 0 bytes assets/go-profiling/golang-profiling-mem.pdf | Bin 19221 -> 0 bytes assets/goaccess/goaccess-dash-html.png | Bin 16129 -> 0 bytes assets/goaccess/goaccess-dash-term.png | Bin 9188 -> 0 bytes assets/helix-editor/editor.png | Bin 159442 -> 0 bytes assets/iot-application/iot-app-output.png | Bin 23767 -> 0 bytes assets/iot-application/iot-rest-example.png | Bin 33912 -> 0 bytes assets/iot-application/iot-sqlite-db.png | Bin 199821 -> 0 bytes assets/iot-application/kcachegrind.png | Bin 88486 -> 0 bytes assets/iot-application/profiling-viewer.png | Bin 173672 -> 0 bytes .../simple-iot-application-overview.svg | 2 - assets/iot-application/simple-iot-application.zip | Bin 6406 -> 0 bytes assets/iot-application/snakeviz.png | Bin 59601 -> 0 bytes assets/pid1/boxes.mp4 | Bin 443830 -> 0 bytes assets/pid1/qemu.log | 320 ---- assets/pid1/unikernels.png | Bin 48567 -> 0 bytes assets/pid1/unikernels.svg | 578 -------- assets/profile-bind-error/error.jpg | Bin 57047 -> 0 bytes assets/python-profiling/kcachegrind.png | Bin 88486 -> 0 bytes assets/python-profiling/profiling-viewer.png | Bin 173672 -> 0 bytes assets/python-profiling/snakeviz.png | Bin 59601 -> 0 bytes .../.ipynb_checkpoints/TF Test-checkpoint.ipynb | 588 -------- .../sentiment-analysis-checkpoint.ipynb | 170 --- .../guardian-sa-title-desc-relationship.png | Bin 15404 -> 0 bytes assets/sentiment-analysis/sentiment-analysis.ipynb | 170 --- assets/simple-pubsub-server/caniuse.png | Bin 56379 -> 0 bytes assets/simple-pubsub-server/chrome-debugging.png | Bin 151160 -> 0 bytes assets/simple-pubsub-server/clients.mp4 | Bin 692780 -> 0 bytes assets/simple-pubsub-server/pubsub-overview.png | Bin 18471 -> 0 bytes assets/simple-pubsub-server/sse-pubsub-server.zip | Bin 4158 -> 0 bytes assets/wap/emulator.mp4 | Bin 892887 -> 0 bytes assets/wap/phones.gif | Bin 348891 -> 0 bytes assets/world-clock/enclosure.stl | Bin 1884 -> 0 bytes assets/world-clock/hardware.jpg | Bin 82279 -> 0 bytes assets/world-clock/world-clock.jpg | Bin 148673 -> 0 bytes assets/yapyap/hello.png | Bin 25962 -> 0 bytes assets/yapyap/pid1.jpg | Bin 394011 -> 0 bytes 92 files changed, 4863 deletions(-) delete mode 100644 assets/algae-sava/dji-algae-0.jpg delete mode 100644 assets/algae-sava/dji-algae-1.jpg delete mode 100644 assets/algae-sava/dji-algae-2.jpg delete mode 100644 assets/algae-sava/dji-algae-3.jpg delete mode 100644 assets/algae-sava/dji-algae-4.jpg delete mode 100644 assets/algae-sava/dji-algae-5.jpg delete mode 100644 assets/cv/avatar.gif delete mode 100644 assets/dfd-rice/desktop.png delete mode 100644 assets/dfd-rice/install-00.png delete mode 100644 assets/dfd-rice/install-01.png delete mode 100644 assets/dfd-rice/install-02.png delete mode 100644 assets/dfd-rice/install-03.png delete mode 100644 assets/dfd-rice/install-04.png delete mode 100644 assets/dfd-rice/install-05.png delete mode 100644 assets/dfd-rice/installation.svg delete mode 100644 assets/dfd-rice/layout.png delete mode 100644 assets/dfd-rice/layout.svg delete mode 100644 assets/dfd-rice/script.png delete mode 100644 assets/dna-sequence/benchmarks.ods delete mode 100644 assets/dna-sequence/chart-encoding-speed.png delete mode 100644 assets/dna-sequence/chart-file-sizes.png delete mode 100644 assets/dna-sequence/dna-basics.jpg delete mode 100644 assets/dna-sequence/quote.png delete mode 100644 assets/dna-sequence/sample-binary-file.png delete mode 100644 assets/dna-sequence/sample.png delete mode 100644 assets/dna-synthesized/bison/in.txt delete mode 100644 assets/dna-synthesized/bison/out.mp3 delete mode 100644 assets/dna-synthesized/bison/spectogram.png delete mode 100755 assets/dna-synthesized/elektron/IMG_0619.jpg delete mode 100755 assets/dna-synthesized/elektron/IMG_0620.jpg delete mode 100755 assets/dna-synthesized/elektron/IMG_0622.jpg delete mode 100755 assets/dna-synthesized/elektron/elektron.mp4 delete mode 100755 assets/dna-synthesized/elektron/midi-studio.jpg delete mode 100644 assets/dna-synthesized/mouse/in.txt delete mode 100644 assets/dna-synthesized/mouse/out.mp3 delete mode 100644 assets/dna-synthesized/mouse/spectogram.png delete mode 100644 assets/dna-synthesized/quote/in.txt delete mode 100644 assets/dna-synthesized/quote/out.mp3 delete mode 100644 assets/dna-synthesized/quote/spectogram.png delete mode 100644 assets/dna-synthesized/symphony-no6-1st-movement.mp3 delete mode 100644 assets/dna-synthesized/symphony-no6-1st-movement.png delete mode 100644 assets/dna-synthesized/taurus/in.txt delete mode 100644 assets/dna-synthesized/taurus/out.mp3 delete mode 100644 assets/dna-synthesized/taurus/spectogram.png delete mode 100644 assets/do-fuse/copy-benchmarks.tsv delete mode 100644 assets/do-fuse/fuse-droplets.png delete mode 100644 assets/do-fuse/fuse-spaces.png delete mode 100644 assets/do-fuse/sqlite-benchmarks.tsv delete mode 100644 assets/dropbox-sync/dropbox-spaces.png delete mode 100644 assets/esp8366-micropython/boards.jpg delete mode 100644 assets/general/alert-dark.svg delete mode 100644 assets/general/alert-light.svg delete mode 100644 assets/general/elasticlunr.min.js delete mode 100644 assets/general/favicon.ico delete mode 100644 assets/general/favicon.png delete mode 100644 assets/go-profiling/golang-profiling-cpu.pdf delete mode 100644 assets/go-profiling/golang-profiling-mem.pdf delete mode 100644 assets/goaccess/goaccess-dash-html.png delete mode 100644 assets/goaccess/goaccess-dash-term.png delete mode 100644 assets/helix-editor/editor.png delete mode 100644 assets/iot-application/iot-app-output.png delete mode 100644 assets/iot-application/iot-rest-example.png delete mode 100644 assets/iot-application/iot-sqlite-db.png delete mode 100644 assets/iot-application/kcachegrind.png delete mode 100644 assets/iot-application/profiling-viewer.png delete mode 100644 assets/iot-application/simple-iot-application-overview.svg delete mode 100644 assets/iot-application/simple-iot-application.zip delete mode 100644 assets/iot-application/snakeviz.png delete mode 100644 assets/pid1/boxes.mp4 delete mode 100644 assets/pid1/qemu.log delete mode 100644 assets/pid1/unikernels.png delete mode 100644 assets/pid1/unikernels.svg delete mode 100644 assets/profile-bind-error/error.jpg delete mode 100644 assets/python-profiling/kcachegrind.png delete mode 100644 assets/python-profiling/profiling-viewer.png delete mode 100644 assets/python-profiling/snakeviz.png delete mode 100644 assets/sentiment-analysis/.ipynb_checkpoints/TF Test-checkpoint.ipynb delete mode 100644 assets/sentiment-analysis/.ipynb_checkpoints/sentiment-analysis-checkpoint.ipynb delete mode 100644 assets/sentiment-analysis/guardian-sa-title-desc-relationship.png delete mode 100644 assets/sentiment-analysis/sentiment-analysis.ipynb delete mode 100644 assets/simple-pubsub-server/caniuse.png delete mode 100644 assets/simple-pubsub-server/chrome-debugging.png delete mode 100644 assets/simple-pubsub-server/clients.mp4 delete mode 100644 assets/simple-pubsub-server/pubsub-overview.png delete mode 100644 assets/simple-pubsub-server/sse-pubsub-server.zip delete mode 100644 assets/wap/emulator.mp4 delete mode 100644 assets/wap/phones.gif delete mode 100644 assets/world-clock/enclosure.stl delete mode 100644 assets/world-clock/hardware.jpg delete mode 100644 assets/world-clock/world-clock.jpg delete mode 100644 assets/yapyap/hello.png delete mode 100644 assets/yapyap/pid1.jpg (limited to 'assets') diff --git a/assets/algae-sava/dji-algae-0.jpg b/assets/algae-sava/dji-algae-0.jpg deleted file mode 100644 index d444c80..0000000 Binary files a/assets/algae-sava/dji-algae-0.jpg and /dev/null differ diff --git a/assets/algae-sava/dji-algae-1.jpg b/assets/algae-sava/dji-algae-1.jpg deleted file mode 100644 index 26ee43c..0000000 Binary files a/assets/algae-sava/dji-algae-1.jpg and /dev/null differ diff --git a/assets/algae-sava/dji-algae-2.jpg b/assets/algae-sava/dji-algae-2.jpg deleted file mode 100644 index d38f8cd..0000000 Binary files a/assets/algae-sava/dji-algae-2.jpg and /dev/null differ diff --git a/assets/algae-sava/dji-algae-3.jpg b/assets/algae-sava/dji-algae-3.jpg deleted file mode 100644 index 9706fa0..0000000 Binary files a/assets/algae-sava/dji-algae-3.jpg and /dev/null differ diff --git a/assets/algae-sava/dji-algae-4.jpg b/assets/algae-sava/dji-algae-4.jpg deleted file mode 100644 index b0db4a2..0000000 Binary files a/assets/algae-sava/dji-algae-4.jpg and /dev/null differ diff --git a/assets/algae-sava/dji-algae-5.jpg b/assets/algae-sava/dji-algae-5.jpg deleted file mode 100644 index f3c1b3b..0000000 Binary files a/assets/algae-sava/dji-algae-5.jpg and /dev/null differ diff --git a/assets/cv/avatar.gif b/assets/cv/avatar.gif deleted file mode 100644 index 82e5f39..0000000 Binary files a/assets/cv/avatar.gif and /dev/null differ diff --git a/assets/dfd-rice/desktop.png b/assets/dfd-rice/desktop.png deleted file mode 100644 index 8dcfd51..0000000 Binary files a/assets/dfd-rice/desktop.png and /dev/null differ diff --git a/assets/dfd-rice/install-00.png b/assets/dfd-rice/install-00.png deleted file mode 100644 index 2660f90..0000000 Binary files a/assets/dfd-rice/install-00.png and /dev/null differ diff --git a/assets/dfd-rice/install-01.png b/assets/dfd-rice/install-01.png deleted file mode 100644 index 1281be1..0000000 Binary files a/assets/dfd-rice/install-01.png and /dev/null differ diff --git a/assets/dfd-rice/install-02.png b/assets/dfd-rice/install-02.png deleted file mode 100644 index 9cac5e3..0000000 Binary files a/assets/dfd-rice/install-02.png and /dev/null differ diff --git a/assets/dfd-rice/install-03.png b/assets/dfd-rice/install-03.png deleted file mode 100644 index dc7cbd1..0000000 Binary files a/assets/dfd-rice/install-03.png and /dev/null differ diff --git a/assets/dfd-rice/install-04.png b/assets/dfd-rice/install-04.png deleted file mode 100644 index 675a78f..0000000 Binary files a/assets/dfd-rice/install-04.png and /dev/null differ diff --git a/assets/dfd-rice/install-05.png b/assets/dfd-rice/install-05.png deleted file mode 100644 index 8b580b9..0000000 Binary files a/assets/dfd-rice/install-05.png and /dev/null differ diff --git a/assets/dfd-rice/installation.svg b/assets/dfd-rice/installation.svg deleted file mode 100644 index 200b71b..0000000 --- a/assets/dfd-rice/installation.svg +++ /dev/null @@ -1,1554 +0,0 @@ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - diff --git a/assets/dfd-rice/layout.png b/assets/dfd-rice/layout.png deleted file mode 100644 index a44d2cd..0000000 Binary files a/assets/dfd-rice/layout.png and /dev/null differ diff --git a/assets/dfd-rice/layout.svg b/assets/dfd-rice/layout.svg deleted file mode 100644 index 880cab3..0000000 --- a/assets/dfd-rice/layout.svg +++ /dev/null @@ -1,132 +0,0 @@ - - - - - - - - - - - TERMINAL - - - BROWSER - - CODE EDITOR - TERMINAL - - - diff --git a/assets/dfd-rice/script.png b/assets/dfd-rice/script.png deleted file mode 100644 index 09be37a..0000000 Binary files a/assets/dfd-rice/script.png and /dev/null differ diff --git a/assets/dna-sequence/benchmarks.ods b/assets/dna-sequence/benchmarks.ods deleted file mode 100644 index 62a8e30..0000000 Binary files a/assets/dna-sequence/benchmarks.ods and /dev/null differ diff --git a/assets/dna-sequence/chart-encoding-speed.png b/assets/dna-sequence/chart-encoding-speed.png deleted file mode 100644 index 7fb106d..0000000 Binary files a/assets/dna-sequence/chart-encoding-speed.png and /dev/null differ diff --git a/assets/dna-sequence/chart-file-sizes.png b/assets/dna-sequence/chart-file-sizes.png deleted file mode 100644 index 31bfa66..0000000 Binary files a/assets/dna-sequence/chart-file-sizes.png and /dev/null differ diff --git a/assets/dna-sequence/dna-basics.jpg b/assets/dna-sequence/dna-basics.jpg deleted file mode 100644 index c2e7f52..0000000 Binary files a/assets/dna-sequence/dna-basics.jpg and /dev/null differ diff --git a/assets/dna-sequence/quote.png b/assets/dna-sequence/quote.png deleted file mode 100644 index 09fb01c..0000000 Binary files a/assets/dna-sequence/quote.png and /dev/null differ diff --git a/assets/dna-sequence/sample-binary-file.png b/assets/dna-sequence/sample-binary-file.png deleted file mode 100644 index 1e4622a..0000000 Binary files a/assets/dna-sequence/sample-binary-file.png and /dev/null differ diff --git a/assets/dna-sequence/sample.png b/assets/dna-sequence/sample.png deleted file mode 100644 index 30f12da..0000000 Binary files a/assets/dna-sequence/sample.png and /dev/null differ diff --git a/assets/dna-synthesized/bison/in.txt b/assets/dna-synthesized/bison/in.txt deleted file mode 100644 index fd1eea6..0000000 --- a/assets/dna-synthesized/bison/in.txt +++ /dev/null @@ -1,11 +0,0 @@ -GGTCAGCCCAAATCCGCACCCTCGGTCACCCTGTTTCCGCCCTCCACGGAGGAGCTCACT -GCCAACAAGGCCACCCTGGTGTGTCTCATCAGCGACTTCTACCCGGGTAGCGTGACCGTG -GCCTGGAAGGCAGACGGCAGCACCATCACCCGCAACGTGGAGACCACCCGGGCCTCCAAA -CAGAGCAACAGCAAGTACGCGAAAAGCGGTTACAGCTGCGAGGTCACGCACGAGGGGAGC -ACCGTGACGAAGACAGTGAAGCCCTCAGCGTGTCAGCCCAAGTCCGCACCCTTGGTCACC -CTGTTCCCGCCCTCCAAGGAGGAGCTCAGCGCCAACAAGGCCACCCTGGTGTGTCTCATC -AGCGACTTCTACCCGGGTAGCGTGACCGTGGTCTGGAAGGCAGACGGCAGCACCATCACC -CGCAACGTGGAGACCACCCGGGCCTCCAAACAGAGCAACAGCAAGTACGCGGCCAGCAGC -TACCTGAGCCTGACGGGCAGCGACTGGAAATCGAAAGGCAGTTACAGCTGCGAGGTCACG -CACGAGGGGAGCACCGTGACGAAGACAGTGAAGGTCTCAGAGTGTCAGCCCAAGTCCGCA - diff --git a/assets/dna-synthesized/bison/out.mp3 b/assets/dna-synthesized/bison/out.mp3 deleted file mode 100644 index d6408ca..0000000 Binary files a/assets/dna-synthesized/bison/out.mp3 and /dev/null differ diff --git a/assets/dna-synthesized/bison/spectogram.png b/assets/dna-synthesized/bison/spectogram.png deleted file mode 100644 index 959902b..0000000 Binary files a/assets/dna-synthesized/bison/spectogram.png and /dev/null differ diff --git a/assets/dna-synthesized/elektron/IMG_0619.jpg b/assets/dna-synthesized/elektron/IMG_0619.jpg deleted file mode 100755 index ebf60b0..0000000 Binary files a/assets/dna-synthesized/elektron/IMG_0619.jpg and /dev/null differ diff --git a/assets/dna-synthesized/elektron/IMG_0620.jpg b/assets/dna-synthesized/elektron/IMG_0620.jpg deleted file mode 100755 index c9aa398..0000000 Binary files a/assets/dna-synthesized/elektron/IMG_0620.jpg and /dev/null differ diff --git a/assets/dna-synthesized/elektron/IMG_0622.jpg b/assets/dna-synthesized/elektron/IMG_0622.jpg deleted file mode 100755 index 98acee4..0000000 Binary files a/assets/dna-synthesized/elektron/IMG_0622.jpg and /dev/null differ diff --git a/assets/dna-synthesized/elektron/elektron.mp4 b/assets/dna-synthesized/elektron/elektron.mp4 deleted file mode 100755 index f8e39b9..0000000 Binary files a/assets/dna-synthesized/elektron/elektron.mp4 and /dev/null differ diff --git a/assets/dna-synthesized/elektron/midi-studio.jpg b/assets/dna-synthesized/elektron/midi-studio.jpg deleted file mode 100755 index 59075cd..0000000 Binary files a/assets/dna-synthesized/elektron/midi-studio.jpg and /dev/null differ diff --git a/assets/dna-synthesized/mouse/in.txt b/assets/dna-synthesized/mouse/in.txt deleted file mode 100644 index abd34a2..0000000 --- a/assets/dna-synthesized/mouse/in.txt +++ /dev/null @@ -1,9 +0,0 @@ -GAATTCTCAGGGCCTGTGATGGTCTATACTGCATGGCATATCAGTGTAGAGAAAATAAAT -AGACACAAGCTCCAATCCCAAACCCAGAAACTATTAATAACAAACGAAAAATTAGTTCTC -TCAAATGAAGTCTCCCTGAGGATACAGATCCCATTCAGATGGGCAGGTCTGCAGGCCAAC -ACAAAATGAACTCAGGGGCCTCTTTGGAGGTCTTAGGTCTCATAATGTTTTGTCAGGCCT -TTTATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTTATTTATCTTAAAACCCACTA -GCTGTTCTCTCCAGGGTCACACCCTAGCACACTCCGTCTAGGTGCCTTCTTACCATCTCC -TCTAAGTGAGTGGAGGCTCCCTGTGTATTTCCACACCCTTGTACTTTAAGTATTTTCAAG -GCAGGGCATATCCTCTCTCACTGAGTCCAGACAAAGCAGCTCAAATAGAAGAACATGTCC -CACATACAGGCAACAGATTTTGAAGGAGGCCTCCACTCCAGCTGTTAGGGGACCCACATG diff --git a/assets/dna-synthesized/mouse/out.mp3 b/assets/dna-synthesized/mouse/out.mp3 deleted file mode 100644 index e66e87b..0000000 Binary files a/assets/dna-synthesized/mouse/out.mp3 and /dev/null differ diff --git a/assets/dna-synthesized/mouse/spectogram.png b/assets/dna-synthesized/mouse/spectogram.png deleted file mode 100644 index 8b7f63f..0000000 Binary files a/assets/dna-synthesized/mouse/spectogram.png and /dev/null differ diff --git a/assets/dna-synthesized/quote/in.txt b/assets/dna-synthesized/quote/in.txt deleted file mode 100644 index 81e8eb9..0000000 --- a/assets/dna-synthesized/quote/in.txt +++ /dev/null @@ -1,8 +0,0 @@ -GACAGCTTGTGTACAAGTGTGCTTGCTCGCGAGCGGGTACGCGCGTGGGCTAACAAGTGA -GCCAGCAGGTGAACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGCTGGCGGGTGA -ACAAGTGTGCCGGTGAGCCAACAAGCAGACAAGTAAGCAGGTACGCAGGCGAGCTTGTCA -ACTCACAAGATCGCTTGTGTACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGTAT -GCTTGCTGGCGGACAAGCCAGCTTGTAAGCGGACAAGCTTGCGCACAAGCTGGCAGGCCT -GCCGGCTCGCGTACAAATTCACAAGTAAGTACGCTTGCGTGTACGCGGGTATGTATACTC -AACCTCACCAAACGGGACAAGATCGCCGGCGGGCTAGTATACAAGAACGCTTGCCAGTAC -AACC \ No newline at end of file diff --git a/assets/dna-synthesized/quote/out.mp3 b/assets/dna-synthesized/quote/out.mp3 deleted file mode 100644 index 985871d..0000000 Binary files a/assets/dna-synthesized/quote/out.mp3 and /dev/null differ diff --git a/assets/dna-synthesized/quote/spectogram.png b/assets/dna-synthesized/quote/spectogram.png deleted file mode 100644 index c460ffd..0000000 Binary files a/assets/dna-synthesized/quote/spectogram.png and /dev/null differ diff --git a/assets/dna-synthesized/symphony-no6-1st-movement.mp3 b/assets/dna-synthesized/symphony-no6-1st-movement.mp3 deleted file mode 100644 index 8c5a609..0000000 Binary files a/assets/dna-synthesized/symphony-no6-1st-movement.mp3 and /dev/null differ diff --git a/assets/dna-synthesized/symphony-no6-1st-movement.png b/assets/dna-synthesized/symphony-no6-1st-movement.png deleted file mode 100644 index 8269f08..0000000 Binary files a/assets/dna-synthesized/symphony-no6-1st-movement.png and /dev/null differ diff --git a/assets/dna-synthesized/taurus/in.txt b/assets/dna-synthesized/taurus/in.txt deleted file mode 100644 index 8c5bddb..0000000 --- a/assets/dna-synthesized/taurus/in.txt +++ /dev/null @@ -1,11 +0,0 @@ -GGTCAGCCCAAGTCCCCACCCTCGGTCACCCTGTTCCCGCCCTCCAAGGAGGAGCTCAGC -GCCAACAAGGCCACCCTGGTGTGTCTCATCAGCGACTTCTACCCGGGTAGCGTGACCGTG -GCCTGGAAGGCAGACGGCAGCACCATCACCCGCAACGTGGAGACCACCCGGGCCTCCAAA -CAGAGCAACAGCAAGTACGCGGCCAGCAGCTACCTGAGCCTGACGAGCAGCGACTGGAAA -TCGAAAGGCAGTTACAGCTGCGAGGTCACGCACGAGGGGAGCACCGTGACGAAGACAGTG -AAGACCTCAGCGTGTCAGCCCAAGTCCCCACCCTCGGTCACCCTGTTCCCGCCCTCCACG -GAGGAGCTCAACGGCAACAAGGCCACCCTGGTGTGTCTCATCAGCGACTTCTACCCGGGT -AGCGTGACCGTGGTCTGGAAGGCAGACGGCAGCACCATCACCCGCAACGTGGAGACCACC -CGGGCCTCCAAACAGAGCAACAGCAAGTACGCGGCCAGCAGCTACCTGAGCCTGACGAGC -AGCGACTGGAAATCGAAAGGCAGTTACAGCTGCGAGGTCACGCACGAGGGGAGCACCGTG -ACGAAGACAGTGAAGCCCTCAGAGTGGCCCTGGGCCCCCACCGCCGTCCCCACCCTCGTC diff --git a/assets/dna-synthesized/taurus/out.mp3 b/assets/dna-synthesized/taurus/out.mp3 deleted file mode 100644 index ea7ae1a..0000000 Binary files a/assets/dna-synthesized/taurus/out.mp3 and /dev/null differ diff --git a/assets/dna-synthesized/taurus/spectogram.png b/assets/dna-synthesized/taurus/spectogram.png deleted file mode 100644 index 3be9b58..0000000 Binary files a/assets/dna-synthesized/taurus/spectogram.png and /dev/null differ diff --git a/assets/do-fuse/copy-benchmarks.tsv b/assets/do-fuse/copy-benchmarks.tsv deleted file mode 100644 index c7a7af4..0000000 --- a/assets/do-fuse/copy-benchmarks.tsv +++ /dev/null @@ -1,101 +0,0 @@ -10KB 100KB 1MB 10MB -0.15 0.187 0.317 0.653 -0.158 0.237 0.192 0.659 -0.134 0.359 0.236 0.604 -0.136 0.292 0.196 0.501 -4.411 4.479 4.376 0.649 -0.134 0.481 0.265 0.608 -0.146 0.266 0.28 0.516 -4.282 0.307 4.549 0.562 -0.152 0.28 0.229 0.512 -0.162 0.37 0.315 0.652 -0.13 4.735 0.222 5.171 -4.29 8.767 0.283 5.076 -4.555 4.682 0.318 4.941 -4.658 4.691 0.177 9.624 -4.778 4.791 4.415 5.114 -8.794 8.604 0.311 5.223 -4.582 4.727 0.234 9.28 -4.596 4.638 0.212 5.064 -4.7 4.65 4.458 5.221 -8.822 9.159 0.191 5.032 -4.628 4.641 0.324 9.226 -4.6 4.921 0.197 5.22 -8.85 4.58 4.405 5.245 -4.65 9.142 0.215 5.168 -4.884 6.67 0.248 9.273 -4.581 4.594 0.248 5.082 -8.864 4.844 4.502 5.121 -4.704 4.656 0.177 5.173 -4.616 8.883 0.209 9.334 -4.729 4.962 4.366 4.966 -8.918 4.682 0.186 6.702 -4.686 4.58 0.168 5.111 -5.123 8.84 4.747 5.084 -4.846 4.732 8.85 5.065 -8.887 4.639 4.824 9.286 -4.681 8.897 4.791 5.104 -4.649 4.682 4.835 5.194 -8.847 4.663 8.929 5.271 -4.568 4.604 4.762 9.444 -4.657 8.74 4.772 5.076 -4.636 4.724 4.838 5.168 -8.778 4.846 9.065 5.057 -4.995 4.571 5.074 9.314 -2.343 9.222 4.818 5.732 -4.742 4.646 8.909 5.32 -4.82 4.842 4.778 5.167 -8.791 4.66 4.759 5.157 -4.835 8.944 4.804 9.323 -4.599 5.594 8.952 5.299 -4.809 4.628 1.567 5.294 -8.744 4.771 5.59 5.018 -4.71 8.919 4.771 9.257 -4.704 4.7 9.003 5.064 -4.765 4.605 4.781 5.185 -8.866 4.669 4.844 5.392 -4.897 8.925 4.786 9.279 -4.568 5.168 8.893 5.1 -4.679 4.757 5.41 5.232 -8.922 4.702 4.7 1.984 -4.669 8.721 4.906 5.366 -4.707 4.555 8.96 5.245 -8.938 4.615 4.89 5.216 -4.608 4.621 4.677 9.237 -4.58 8.954 4.908 5.194 -4.707 4.575 8.968 5.017 -8.822 4.781 4.882 9.714 -4.674 8.833 4.834 5.02 -5.005 4.689 4.762 5.312 -4.732 4.799 9.111 5.286 -8.894 4.675 4.936 5.185 -4.747 8.764 4.739 9.312 -4.785 4.749 4.845 5.34 -4.656 4.705 9.181 5.256 -8.899 4.601 4.739 5.261 -4.594 8.813 4.576 9.329 -4.585 4.716 8.813 5.343 -8.718 4.723 4.819 5.092 -4.725 4.757 4.83 5.061 -4.737 8.899 4.772 9.488 -4.692 4.717 8.831 5.13 -8.841 4.951 4.787 5.309 -4.66 8.895 4.746 5.228 -4.749 4.595 4.833 5.26 -4.715 4.615 8.928 9.381 -8.849 4.651 4.826 5.289 -4.66 8.897 4.802 5.197 -4.588 4.844 4.883 9.311 -4.753 4.888 9.053 5.072 -8.841 4.737 4.75 5.157 -4.794 8.976 5.063 5.196 -4.544 4.673 9.036 9.335 -8.74 4.654 6.377 5.29 -4.729 4.752 5.001 5.048 -4.654 8.98 4.873 5.544 -4.9 4.606 4.723 5.192 -8.757 4.802 5.427 9.056 -4.859 8.969 4.816 5.3 -4.701 4.662 9.002 5.138 -4.943 4.813 4.894 5.15 -8.772 4.721 4.785 9.168 diff --git a/assets/do-fuse/fuse-droplets.png b/assets/do-fuse/fuse-droplets.png deleted file mode 100644 index d7ce243..0000000 Binary files a/assets/do-fuse/fuse-droplets.png and /dev/null differ diff --git a/assets/do-fuse/fuse-spaces.png b/assets/do-fuse/fuse-spaces.png deleted file mode 100644 index 4dcc1c5..0000000 Binary files a/assets/do-fuse/fuse-spaces.png and /dev/null differ diff --git a/assets/do-fuse/sqlite-benchmarks.tsv b/assets/do-fuse/sqlite-benchmarks.tsv deleted file mode 100644 index daa2c21..0000000 --- a/assets/do-fuse/sqlite-benchmarks.tsv +++ /dev/null @@ -1,1001 +0,0 @@ -DROPTABLE CREATETABLE INSERTMANY FETCHALL COMMIT -0.000732 0.000400 0.008133 0.000065 0.000166 -0.000200 0.000214 0.003105 0.000043 0.000171 -0.000246 0.000170 0.006594 0.000044 0.000101 -0.000182 0.000166 0.003892 0.000043 0.000112 -0.000248 0.000654 0.002308 0.000041 0.000090 -0.000240 0.000184 0.002253 0.000053 0.000110 -0.000698 0.000483 0.003737 0.000041 0.000165 -0.000217 0.000179 0.002470 0.000049 0.000107 -0.000243 0.000160 0.002668 0.000054 0.000340 -0.000196 0.000169 0.002247 0.000040 0.000096 -0.000191 0.000162 0.003522 0.000260 0.000102 -0.000195 0.000188 0.002325 0.000041 0.000132 -0.000194 0.000202 0.002291 0.000039 0.000091 -0.000195 0.000196 0.004114 0.000042 0.000108 -0.000204 0.000200 0.002971 0.000040 0.000106 -0.000227 0.000159 0.002208 0.000039 0.000117 -0.000207 0.000176 0.003558 0.000040 0.000124 -0.000255 0.000179 0.002870 0.000040 0.000125 -0.000209 0.000176 0.002248 0.000040 0.000176 -0.000211 0.000174 0.002661 0.000039 0.000180 -0.000208 0.000219 0.002321 0.000039 0.000151 -0.000212 0.000178 0.002609 0.000040 0.000132 -0.000205 0.000209 0.002666 0.000039 0.000126 -0.000205 0.000176 0.002501 0.000041 0.000133 -0.000243 0.000183 0.002220 0.000037 0.000117 -0.000504 0.000173 0.002230 0.000121 0.000414 -0.000270 0.000200 0.002325 0.000040 0.000154 -0.000208 0.000176 0.002386 0.000038 0.000123 -0.000229 0.000182 0.002245 0.000039 0.000127 -0.000211 0.000176 0.002544 0.000039 0.000136 -0.000204 0.000180 0.002133 0.000037 0.000129 -0.000205 0.000178 0.002330 0.000048 0.000146 -0.000210 0.000178 0.002242 0.000039 0.000109 -0.000210 0.000259 0.002766 0.000039 0.000118 -0.000317 0.000495 0.002237 0.000039 0.000195 -0.000454 0.000246 0.002447 0.000040 0.000172 -0.000936 0.000200 0.002305 0.000057 0.000173 -0.000263 0.000178 0.002251 0.000038 0.000166 -0.000240 0.000183 0.002169 0.000068 0.000176 -0.000251 0.000189 0.002221 0.000038 0.000141 -0.000268 0.000215 0.002322 0.000039 0.000226 -0.000287 0.000223 0.002696 0.000045 0.000247 -0.000362 0.000229 0.002551 0.000043 0.000133 -0.000239 0.000200 0.002621 0.000045 0.000133 -0.000634 0.000208 0.002619 0.000046 0.000138 -0.000236 0.000205 0.002589 0.000046 0.000137 -0.000262 0.000205 0.002607 0.000045 0.000142 -0.000239 0.000198 0.002754 0.000044 0.000185 -0.000238 0.000198 0.002593 0.000057 0.000160 -0.000242 0.000221 0.003784 0.000122 0.000174 -0.000242 0.000201 0.002625 0.000054 0.000148 -0.000296 0.000225 0.002934 0.000044 0.000134 -0.000239 0.000245 0.003428 0.000046 0.000158 -0.000261 0.000251 0.002569 0.000046 0.000139 -0.000260 0.000230 0.002603 0.000045 0.000145 -0.000302 0.000212 0.002580 0.000045 0.000176 -0.000794 0.000197 0.002856 0.000046 0.000141 -0.000273 0.000209 0.003173 0.000045 0.000217 -0.000240 0.000201 0.002844 0.000043 0.000167 -0.000389 0.000175 0.004315 0.000055 0.000091 -0.000275 0.000534 0.004991 0.000053 0.000092 -0.000229 0.000215 0.004084 0.000045 0.000074 -0.000172 0.000474 0.002611 0.000043 0.000069 -0.000201 0.000174 0.002485 0.000043 0.000069 -0.000173 0.000220 0.002541 0.000045 0.000068 -0.000167 0.000161 0.002827 0.000043 0.000071 -0.000168 0.000160 0.003512 0.000068 0.000075 -0.000211 0.000167 0.002530 0.000044 0.000069 -0.000193 0.000230 0.003664 0.000046 0.000074 -0.000171 0.000161 0.002575 0.000076 0.000075 -0.000169 0.000161 0.002595 0.000044 0.000076 -0.000981 0.000174 0.002556 0.000045 0.000072 -0.000168 0.000163 0.002568 0.000043 0.000072 -0.000163 0.000158 0.002579 0.000043 0.000386 -0.000168 0.000160 0.002579 0.000059 0.000088 -0.000176 0.000163 0.002559 0.000044 0.000075 -0.000167 0.000161 0.002558 0.000043 0.000075 -0.000169 0.000161 0.002599 0.000043 0.000095 -0.000174 0.000163 0.002633 0.000046 0.000076 -0.000170 0.000165 0.002576 0.000858 0.000079 -0.000169 0.000162 0.002611 0.000044 0.000075 -0.000170 0.000199 0.002621 0.000043 0.000074 -0.000170 0.000167 0.003611 0.000043 0.000073 -0.000171 0.000159 0.002764 0.000046 0.000076 -0.000171 0.000165 0.002639 0.000044 0.000073 -0.000168 0.000162 0.003131 0.000046 0.000075 -0.000170 0.000162 0.002858 0.000044 0.000074 -0.000171 0.000164 0.002841 0.000043 0.000075 -0.000167 0.000161 0.002971 0.000043 0.000074 -0.000170 0.000226 0.002842 0.000044 0.000074 -0.000171 0.000165 0.002822 0.000044 0.000075 -0.000173 0.000160 0.002895 0.000045 0.000073 -0.000167 0.000217 0.002697 0.000044 0.000076 -0.000170 0.000197 0.002699 0.000044 0.000075 -0.000171 0.000163 0.003230 0.000045 0.000097 -0.000170 0.000164 0.003167 0.000046 0.000082 -0.000172 0.000196 0.002559 0.000043 0.000075 -0.000168 0.000165 0.003006 0.000045 0.000075 -0.000176 0.000160 0.002567 0.000043 0.000075 -0.000167 0.000163 0.002757 0.000045 0.000076 -0.000171 0.000162 0.002802 0.000045 0.000076 -0.000169 0.000162 0.003102 0.000043 0.000072 -0.000167 0.000162 0.002624 0.000043 0.000075 -0.000170 0.000161 0.002589 0.000043 0.000072 -0.000222 0.000253 0.002657 0.000045 0.000075 -0.000172 0.000162 0.002586 0.000044 0.000084 -0.000172 0.000165 0.002933 0.000044 0.000075 -0.000169 0.000192 0.002609 0.000044 0.000074 -0.000194 0.000162 0.003020 0.000045 0.000081 -0.000170 0.000164 0.002908 0.000045 0.000076 -0.000169 0.000163 0.002567 0.000042 0.000073 -0.000167 0.000159 0.003071 0.000042 0.000074 -0.000222 0.000163 0.003175 0.000043 0.000076 -0.000167 0.000160 0.002641 0.000046 0.000099 -0.000171 0.000168 0.002586 0.000057 0.000075 -0.000170 0.000168 0.003148 0.000046 0.000075 -0.000171 0.000159 0.002770 0.000041 0.000074 -0.000173 0.000158 0.002643 0.000055 0.000077 -0.000313 0.000174 0.002920 0.000045 0.000075 -0.000170 0.000163 0.002551 0.000044 0.000072 -0.000173 0.000161 0.002599 0.000045 0.000073 -0.000167 0.000160 0.003505 0.000046 0.000075 -0.000171 0.000161 0.002894 0.000045 0.000074 -0.000171 0.000166 0.002572 0.000042 0.000073 -0.000166 0.000160 0.004099 0.000044 0.000102 -0.000181 0.000160 0.002499 0.000046 0.000071 -0.000174 0.000175 0.002560 0.000043 0.000068 -0.000165 0.000168 0.003083 0.000044 0.000070 -0.000210 0.000163 0.002535 0.000040 0.000068 -0.000164 0.000177 0.002906 0.000044 0.000075 -0.000175 0.000227 0.002971 0.000043 0.000073 -0.000167 0.000175 0.003409 0.000046 0.000078 -0.000172 0.000166 0.002640 0.000046 0.000074 -0.000177 0.000164 0.002574 0.000046 0.000076 -0.000170 0.000163 0.002631 0.000046 0.000075 -0.000216 0.000168 0.002596 0.000046 0.000076 -0.000170 0.000163 0.002659 0.000045 0.000074 -0.000172 0.000162 0.002677 0.000046 0.000075 -0.000170 0.000159 0.002604 0.000044 0.000081 -0.000171 0.000161 0.003163 0.000046 0.000076 -0.000171 0.000162 0.002574 0.000313 0.000075 -0.000170 0.000186 0.002988 0.000046 0.000074 -0.000171 0.000162 0.002596 0.000043 0.000077 -0.000168 0.000160 0.002640 0.000055 0.000074 -0.000169 0.000161 0.002567 0.000043 0.000371 -0.000170 0.000162 0.002704 0.000057 0.000078 -0.000255 0.000185 0.002453 0.000293 0.000066 -0.000148 0.000143 0.002169 0.000037 0.000066 -0.000173 0.000141 0.002238 0.000039 0.000085 -0.000154 0.000174 0.002679 0.000041 0.000065 -0.000149 0.000144 0.002187 0.000037 0.000065 -0.000146 0.000140 0.002760 0.000039 0.000071 -0.000147 0.000151 0.002193 0.000039 0.000065 -0.000150 0.000172 0.002207 0.000039 0.000067 -0.000147 0.000141 0.002126 0.000037 0.000060 -0.000191 0.000141 0.002119 0.000036 0.000086 -0.000149 0.000144 0.002440 0.000039 0.000065 -0.000148 0.000143 0.003287 0.000041 0.000068 -0.000152 0.000149 0.002555 0.000040 0.000069 -0.000148 0.000141 0.002203 0.000038 0.000065 -0.000147 0.000139 0.002371 0.000052 0.000075 -0.000148 0.000143 0.002201 0.000037 0.000066 -0.000149 0.000140 0.002186 0.000038 0.000062 -0.000152 0.000154 0.002215 0.000038 0.000062 -0.000149 0.000144 0.002505 0.000039 0.000067 -0.000148 0.000140 0.002216 0.000038 0.000101 -0.000160 0.000144 0.002574 0.000039 0.000067 -0.000150 0.000144 0.002266 0.000040 0.000068 -0.000151 0.000142 0.003640 0.000040 0.000068 -0.000150 0.000142 0.002207 0.000038 0.000066 -0.000148 0.000140 0.002337 0.000041 0.000068 -0.000151 0.000144 0.002138 0.000038 0.000063 -0.000146 0.000178 0.002369 0.000039 0.000060 -0.000150 0.000141 0.002290 0.000039 0.000067 -0.000149 0.000143 0.002569 0.000050 0.000070 -0.000149 0.000143 0.002797 0.000040 0.000068 -0.000149 0.000143 0.002720 0.000039 0.000066 -0.000273 0.000154 0.002255 0.000039 0.000066 -0.000147 0.000141 0.002180 0.000037 0.000065 -0.000884 0.000142 0.002164 0.000036 0.000060 -0.000188 0.000143 0.002248 0.000039 0.000062 -0.000148 0.000142 0.002178 0.000038 0.000064 -0.000151 0.000140 0.002705 0.000038 0.000063 -0.000145 0.000144 0.002588 0.000039 0.000064 -0.000147 0.000142 0.002196 0.000037 0.000064 -0.000147 0.000139 0.002169 0.000035 0.000060 -0.000151 0.000894 0.002267 0.000039 0.000061 -0.000152 0.000145 0.002178 0.000038 0.000061 -0.000185 0.000142 0.002148 0.000036 0.000062 -0.000147 0.000141 0.002845 0.000040 0.000065 -0.000159 0.000178 0.002193 0.000039 0.000063 -0.000145 0.000141 0.002571 0.000039 0.000066 -0.000149 0.000141 0.003380 0.000038 0.000065 -0.000200 0.000149 0.002439 0.000039 0.000066 -0.000152 0.000140 0.002193 0.000037 0.000065 -0.000147 0.000139 0.002239 0.000037 0.000066 -0.000200 0.000143 0.002190 0.000039 0.000066 -0.000147 0.000139 0.002243 0.000038 0.000062 -0.000421 0.000144 0.002229 0.000038 0.000062 -0.000147 0.000149 0.002715 0.000038 0.000063 -0.000151 0.000176 0.002144 0.000036 0.000060 -0.000145 0.000138 0.002184 0.000038 0.000064 -0.000146 0.000207 0.002526 0.000040 0.000067 -0.000163 0.000142 0.002366 0.000038 0.000070 -0.000149 0.000143 0.002143 0.000038 0.000065 -0.000150 0.000142 0.002146 0.000035 0.000059 -0.000162 0.000147 0.002736 0.000038 0.000067 -0.000149 0.000146 0.002383 0.000040 0.000071 -0.000147 0.000139 0.002485 0.000038 0.000065 -0.000147 0.000143 0.002811 0.000039 0.000098 -0.000181 0.000142 0.002503 0.000039 0.000066 -0.000150 0.000143 0.002227 0.000039 0.000065 -0.000149 0.000143 0.002182 0.000036 0.000061 -0.000148 0.000387 0.002159 0.000036 0.000059 -0.000147 0.000173 0.002267 0.000039 0.000063 -0.000147 0.000143 0.002729 0.000039 0.000066 -0.000149 0.000142 0.002574 0.000040 0.000069 -0.000149 0.000143 0.002560 0.000040 0.000068 -0.000152 0.000141 0.002203 0.000038 0.000066 -0.000151 0.000139 0.002234 0.000038 0.000087 -0.000148 0.000140 0.002152 0.000036 0.000060 -0.000185 0.000140 0.002274 0.000039 0.000063 -0.000148 0.000144 0.002211 0.000038 0.000066 -0.000149 0.000141 0.002692 0.000039 0.000066 -0.000148 0.000145 0.002519 0.000039 0.000066 -0.000147 0.000143 0.002188 0.000038 0.000066 -0.000149 0.000171 0.002171 0.000038 0.000093 -0.000150 0.000182 0.002185 0.000038 0.000068 -0.000191 0.000154 0.002172 0.000037 0.000061 -0.000145 0.000140 0.002253 0.000043 0.000065 -0.000147 0.000139 0.002673 0.000038 0.000066 -0.000191 0.000144 0.002740 0.000038 0.000066 -0.000147 0.000142 0.002187 0.000038 0.000064 -0.000146 0.000181 0.002180 0.000038 0.000066 -0.000176 0.000142 0.002152 0.000039 0.000061 -0.000149 0.000142 0.002164 0.000037 0.000064 -0.000245 0.000150 0.002771 0.000055 0.000084 -0.000149 0.000145 0.003006 0.000040 0.000069 -0.000153 0.000144 0.002701 0.000040 0.000067 -0.000149 0.000144 0.002192 0.000038 0.000065 -0.000148 0.000143 0.002220 0.000038 0.000063 -0.000146 0.000140 0.002210 0.000038 0.000062 -0.000157 0.000144 0.002174 0.000038 0.000060 -0.000148 0.000171 0.002208 0.000039 0.000061 -0.000146 0.000141 0.002685 0.000039 0.000064 -0.000146 0.000139 0.002811 0.000038 0.000064 -0.000147 0.000140 0.002234 0.000037 0.000063 -0.000143 0.000143 0.002209 0.000040 0.000066 -0.000149 0.000144 0.002162 0.000037 0.000091 -0.000408 0.000141 0.002140 0.000036 0.000060 -0.000142 0.000149 0.002208 0.000132 0.000061 -0.000148 0.000142 0.002706 0.000040 0.000066 -0.000148 0.000142 0.002502 0.000039 0.000065 -0.000176 0.000144 0.002265 0.000039 0.000066 -0.000150 0.000142 0.002199 0.000039 0.000065 -0.000147 0.000154 0.002201 0.000040 0.000067 -0.000150 0.000142 0.002164 0.000036 0.000094 -0.000183 0.000177 0.002253 0.000039 0.000063 -0.000189 0.000143 0.002480 0.000039 0.000066 -0.000148 0.000141 0.002212 0.000037 0.000064 -0.000150 0.000137 0.002192 0.000037 0.000065 -0.000144 0.000140 0.002271 0.000039 0.000062 -0.000190 0.000171 0.002145 0.000037 0.000061 -0.000146 0.000141 0.005865 0.000099 0.000083 -0.000178 0.000165 0.002792 0.000040 0.000066 -0.000148 0.000233 0.002742 0.000039 0.000079 -0.000157 0.000151 0.002225 0.000039 0.000066 -0.000149 0.000142 0.002215 0.000039 0.000081 -0.000165 0.000141 0.002239 0.000039 0.000081 -0.000150 0.000154 0.002154 0.000036 0.000060 -0.000152 0.000151 0.002216 0.000039 0.000075 -0.000172 0.000141 0.004471 0.000060 0.000092 -0.000250 0.000210 0.002881 0.000040 0.000066 -0.000176 0.000152 0.002262 0.000038 0.000337 -0.000164 0.000154 0.002485 0.000039 0.000074 -0.000149 0.000180 0.002148 0.000039 0.000078 -0.000194 0.000145 0.002345 0.000044 0.000064 -0.000164 0.000201 0.002483 0.000040 0.000062 -0.000148 0.000140 0.002249 0.000038 0.000076 -0.000155 0.000144 0.002504 0.000039 0.000067 -0.000166 0.000150 0.002780 0.000040 0.000079 -0.000150 0.000142 0.002194 0.000038 0.000086 -0.000178 0.000153 0.002360 0.000039 0.000079 -0.000160 0.000154 0.002159 0.000036 0.000079 -0.000195 0.000445 0.002203 0.000038 0.000074 -0.000171 0.000161 0.002220 0.000038 0.000087 -0.000165 0.000151 0.002231 0.000038 0.000088 -0.000149 0.000141 0.003445 0.000040 0.000068 -0.000148 0.000143 0.002465 0.000039 0.000081 -0.000165 0.000150 0.002228 0.000038 0.000067 -0.000160 0.000142 0.003231 0.000039 0.000066 -0.000149 0.000141 0.002215 0.000038 0.000078 -0.000146 0.000152 0.002152 0.000038 0.000077 -0.000168 0.000140 0.002258 0.000040 0.000076 -0.000193 0.000142 0.002266 0.000039 0.000085 -0.000261 0.000164 0.002160 0.000037 0.000061 -0.000151 0.000419 0.002217 0.000037 0.000073 -0.000163 0.000148 0.002856 0.000038 0.000106 -0.000258 0.000204 0.002267 0.000040 0.000075 -0.000178 0.000159 0.002266 0.000038 0.000070 -0.000158 0.000149 0.002665 0.000039 0.000085 -0.000164 0.000154 0.002478 0.000039 0.000077 -0.000148 0.000140 0.002459 0.000038 0.000066 -0.000161 0.000142 0.002206 0.000038 0.000074 -0.000155 0.000151 0.002230 0.000039 0.000083 -0.000161 0.000142 0.002225 0.000037 0.000072 -0.000161 0.000187 0.002450 0.000038 0.000063 -0.000145 0.000155 0.002438 0.000039 0.000079 -0.000166 0.000138 0.002296 0.000039 0.000076 -0.000170 0.000156 0.002446 0.000038 0.000078 -0.000160 0.000159 0.002211 0.000038 0.000078 -0.000159 0.000142 0.002190 0.000036 0.000110 -0.000157 0.000150 0.002336 0.000039 0.000073 -0.000165 0.000182 0.002132 0.000038 0.000072 -0.000160 0.000140 0.002641 0.000066 0.000066 -0.000147 0.000153 0.002153 0.000039 0.000080 -0.000148 0.000156 0.002165 0.000037 0.000077 -0.000147 0.000151 0.002201 0.000038 0.000067 -0.000162 0.000143 0.002216 0.000040 0.000080 -0.000165 0.000148 0.002223 0.000055 0.000080 -0.000193 0.000143 0.002155 0.000037 0.000078 -0.000165 0.000143 0.003005 0.000040 0.000067 -0.000151 0.000145 0.002511 0.000039 0.000070 -0.000149 0.000173 0.002246 0.000039 0.000066 -0.000148 0.000143 0.002808 0.000040 0.000067 -0.000148 0.000142 0.002513 0.000038 0.000066 -0.000148 0.000143 0.002203 0.000037 0.000065 -0.000146 0.000138 0.002123 0.000038 0.000061 -0.000170 0.000149 0.002165 0.000036 0.000062 -0.000144 0.000145 0.002186 0.000037 0.000059 -0.000144 0.000139 0.002520 0.000037 0.000065 -0.000146 0.000139 0.002559 0.000038 0.000066 -0.000153 0.000142 0.002537 0.000038 0.000067 -0.000168 0.000144 0.002217 0.000048 0.000066 -0.000147 0.000141 0.002120 0.000037 0.000063 -0.000188 0.001725 0.002541 0.000040 0.000067 -0.000149 0.000143 0.002229 0.000038 0.000076 -0.000147 0.000143 0.002233 0.000037 0.000062 -0.000182 0.000142 0.002150 0.000037 0.000061 -0.000148 0.000140 0.002196 0.000037 0.000065 -0.000145 0.000140 0.002473 0.000037 0.000065 -0.000147 0.000139 0.002725 0.000040 0.000067 -0.000149 0.000142 0.002217 0.000039 0.000065 -0.000146 0.000140 0.002167 0.000037 0.000061 -0.000176 0.000144 0.002415 0.000039 0.000064 -0.000171 0.000144 0.002925 0.000040 0.000068 -0.000152 0.000167 0.002190 0.000039 0.000066 -0.000149 0.000142 0.002530 0.000039 0.000067 -0.000150 0.000142 0.003059 0.000040 0.000068 -0.000149 0.000142 0.002417 0.000038 0.000072 -0.000149 0.000143 0.002569 0.000038 0.000068 -0.000148 0.000141 0.002262 0.000040 0.000068 -0.000152 0.000144 0.002253 0.000038 0.000066 -0.000149 0.000142 0.002134 0.000037 0.000061 -0.000277 0.000427 0.002186 0.000036 0.000060 -0.000145 0.000139 0.002791 0.000039 0.000065 -0.000149 0.000144 0.002238 0.000039 0.000066 -0.000147 0.000144 0.002514 0.000039 0.000066 -0.000148 0.000143 0.002683 0.000038 0.000063 -0.000147 0.000139 0.002214 0.000037 0.000068 -0.000145 0.000139 0.002149 0.000036 0.000059 -0.000185 0.000139 0.002214 0.000037 0.000060 -0.000145 0.000140 0.003549 0.000039 0.000066 -0.000187 0.000142 0.002160 0.000037 0.000059 -0.000147 0.000158 0.002212 0.000038 0.000065 -0.000148 0.000140 0.002483 0.000039 0.000067 -0.000147 0.000142 0.003034 0.000039 0.000066 -0.000148 0.000142 0.002228 0.000039 0.000066 -0.000145 0.000151 0.002225 0.000040 0.000067 -0.000149 0.000142 0.002858 0.000048 0.000083 -0.000203 0.000185 0.004022 0.000049 0.000086 -0.000212 0.000188 0.005086 0.000056 0.000093 -0.000220 0.000203 0.004209 0.000051 0.000085 -0.000208 0.000247 0.009261 0.000098 0.000089 -0.000211 0.000262 0.002546 0.000041 0.000066 -0.000198 0.000150 0.002534 0.000039 0.000079 -0.000159 0.000143 0.002207 0.000038 0.000094 -0.000157 0.000143 0.002173 0.000038 0.000062 -0.000198 0.000505 0.002157 0.000039 0.000079 -0.000164 0.000143 0.002172 0.000038 0.000076 -0.000156 0.000148 0.002259 0.000039 0.000080 -0.000161 0.000142 0.002219 0.000039 0.000076 -0.000161 0.000143 0.002266 0.000039 0.000085 -0.000161 0.000141 0.002150 0.000036 0.000077 -0.000179 0.000140 0.002140 0.000036 0.000071 -0.000157 0.000151 0.002316 0.000040 0.000079 -0.000149 0.000143 0.002269 0.000039 0.000066 -0.000161 0.000142 0.002206 0.000040 0.000091 -0.000172 0.000143 0.002244 0.000039 0.000067 -0.000168 0.000142 0.002189 0.000039 0.000083 -0.000163 0.000188 0.002156 0.000037 0.000077 -0.000168 0.000143 0.002266 0.000039 0.000084 -0.000166 0.000147 0.002205 0.000325 0.000078 -0.000175 0.000140 0.002173 0.000037 0.000106 -0.000170 0.000153 0.002158 0.000036 0.000083 -0.000168 0.000147 0.002825 0.000039 0.000108 -0.000172 0.000151 0.002483 0.000038 0.000085 -0.000160 0.000143 0.002163 0.000038 0.000066 -0.000161 0.000154 0.002493 0.000039 0.000084 -0.000167 0.000153 0.002564 0.000040 0.000082 -0.000159 0.000151 0.002185 0.000046 0.000088 -0.000157 0.000156 0.002175 0.000039 0.000076 -0.000150 0.000144 0.002151 0.000038 0.000063 -0.000160 0.000140 0.002429 0.000038 0.000064 -0.000160 0.000154 0.002184 0.000048 0.000077 -0.000168 0.000142 0.002686 0.000040 0.000119 -0.000164 0.000152 0.002279 0.000039 0.000075 -0.000161 0.000143 0.002192 0.000068 0.000067 -0.000161 0.000154 0.002190 0.000040 0.000092 -0.000246 0.000146 0.003064 0.000038 0.000072 -0.000163 0.000158 0.002171 0.000037 0.000073 -0.000216 0.000144 0.002209 0.000039 0.000115 -0.000159 0.000141 0.003338 0.000039 0.000079 -0.000277 0.000158 0.002464 0.000039 0.000082 -0.000168 0.000150 0.002227 0.000037 0.000079 -0.000168 0.000146 0.002775 0.000038 0.000077 -0.000146 0.000147 0.002694 0.000042 0.000084 -0.000160 0.000145 0.002807 0.000039 0.000066 -0.000162 0.000177 0.002187 0.000063 0.000066 -0.000147 0.000141 0.002220 0.000038 0.000085 -0.000160 0.000142 0.002216 0.000037 0.000077 -0.000166 0.000159 0.002224 0.000039 0.000108 -0.000147 0.000141 0.002746 0.000039 0.000078 -0.000159 0.000141 0.002194 0.000037 0.000063 -0.000164 0.000143 0.002164 0.000039 0.000067 -0.000169 0.000152 0.002278 0.000074 0.000088 -0.000157 0.000157 0.002155 0.000068 0.000076 -0.000159 0.000140 0.002170 0.000035 0.000078 -0.000156 0.000141 0.002299 0.000040 0.000066 -0.000192 0.000160 0.002241 0.000039 0.000082 -0.000149 0.000143 0.002288 0.000039 0.000079 -0.000161 0.000142 0.002185 0.000049 0.000077 -0.000147 0.000149 0.002284 0.000039 0.000063 -0.000456 0.000144 0.002203 0.000046 0.000064 -0.000187 0.000144 0.002147 0.000037 0.000061 -0.000147 0.000140 0.002238 0.000040 0.000067 -0.000147 0.000140 0.003077 0.000041 0.000068 -0.000151 0.000142 0.002226 0.000038 0.000065 -0.000146 0.000142 0.002188 0.000039 0.000065 -0.000145 0.000141 0.002156 0.000036 0.000061 -0.000143 0.000172 0.002379 0.000037 0.000060 -0.000152 0.000231 0.002172 0.000038 0.000065 -0.000153 0.000142 0.002181 0.000039 0.000065 -0.000148 0.000142 0.002567 0.000039 0.000067 -0.000150 0.000142 0.002177 0.000038 0.000072 -0.000147 0.000146 0.002328 0.000038 0.000063 -0.000146 0.000150 0.002211 0.000038 0.000063 -0.000149 0.000143 0.002222 0.000040 0.000072 -0.000150 0.000144 0.002455 0.000039 0.000065 -0.000147 0.000144 0.002206 0.000039 0.000066 -0.000145 0.000141 0.002153 0.000055 0.000070 -0.000443 0.000144 0.002139 0.000036 0.000069 -0.000147 0.000182 0.002188 0.000037 0.000061 -0.000146 0.000138 0.002248 0.000038 0.000067 -0.000147 0.000142 0.002817 0.000039 0.000067 -0.000148 0.000144 0.002230 0.000038 0.000066 -0.000148 0.000142 0.002239 0.000039 0.000067 -0.000149 0.000142 0.002197 0.000038 0.000063 -0.000181 0.000674 0.002170 0.000038 0.000061 -0.000146 0.000195 0.002204 0.000037 0.000061 -0.000146 0.000141 0.002260 0.000039 0.000067 -0.000150 0.000142 0.002193 0.000045 0.000065 -0.000147 0.000140 0.002229 0.000036 0.000066 -0.000146 0.000137 0.002197 0.000037 0.000062 -0.000152 0.000159 0.002187 0.000036 0.000060 -0.000145 0.000139 0.002224 0.000037 0.000064 -0.000149 0.000144 0.002175 0.000038 0.000066 -0.000150 0.000143 0.002187 0.000038 0.000066 -0.000148 0.000141 0.002152 0.000036 0.000061 -0.000185 0.000141 0.002176 0.000036 0.000064 -0.000169 0.000145 0.002483 0.000038 0.000067 -0.000149 0.000141 0.002225 0.000036 0.000064 -0.000244 0.000149 0.002538 0.000038 0.000065 -0.000156 0.000143 0.002317 0.000039 0.000297 -0.000228 0.000172 0.002222 0.000039 0.000300 -0.000149 0.000145 0.002173 0.000040 0.000066 -0.000154 0.000145 0.002155 0.000038 0.000093 -0.000161 0.000145 0.002178 0.000039 0.000063 -0.000147 0.000170 0.002299 0.000039 0.000066 -0.000149 0.000142 0.003494 0.000040 0.000066 -0.000149 0.000178 0.002237 0.000038 0.000062 -0.000148 0.000143 0.002150 0.000037 0.000064 -0.000146 0.000139 0.002315 0.000038 0.000065 -0.000147 0.000141 0.002269 0.000039 0.000067 -0.000173 0.000145 0.002191 0.000037 0.000065 -0.000166 0.000144 0.002247 0.000038 0.000061 -0.000146 0.000140 0.002551 0.000038 0.000065 -0.000148 0.000175 0.002202 0.000037 0.000064 -0.000145 0.000141 0.002217 0.000038 0.000063 -0.000146 0.000138 0.002164 0.000132 0.000547 -0.000148 0.000144 0.008140 0.000160 0.000893 -0.000311 0.000221 0.004526 0.000058 0.000109 -0.000238 0.000225 0.003475 0.000044 0.000094 -0.000178 0.000177 0.002537 0.000041 0.000087 -0.000172 0.000161 0.002194 0.000048 0.000084 -0.000172 0.000163 0.002177 0.000040 0.000084 -0.001177 0.000156 0.002351 0.000041 0.000325 -0.000167 0.000163 0.002273 0.000040 0.000088 -0.000170 0.000151 0.002245 0.000040 0.000077 -0.000172 0.000896 0.002181 0.000038 0.000080 -0.000202 0.000164 0.002449 0.000038 0.000076 -0.000162 0.000161 0.002188 0.000037 0.000078 -0.000165 0.000154 0.002440 0.000074 0.000091 -0.000167 0.000149 0.002185 0.000039 0.000081 -0.000176 0.000154 0.002427 0.000040 0.000093 -0.000168 0.000154 0.002304 0.000038 0.000105 -0.000672 0.000160 0.002260 0.000038 0.000088 -0.000686 0.000159 0.002207 0.000038 0.000084 -0.000163 0.000154 0.002186 0.000037 0.000077 -0.000173 0.000153 0.002399 0.000038 0.000082 -0.000166 0.000157 0.002709 0.000039 0.000077 -0.000155 0.000149 0.002143 0.000038 0.000097 -0.000166 0.000154 0.003454 0.000051 0.000106 -0.000166 0.000160 0.002539 0.000039 0.000128 -0.000169 0.000149 0.002307 0.000039 0.000085 -0.000170 0.000158 0.002225 0.000040 0.000088 -0.000170 0.000180 0.002165 0.000036 0.000103 -0.000203 0.000160 0.002345 0.000039 0.000075 -0.000173 0.000191 0.002160 0.000038 0.000074 -0.000165 0.000156 0.002243 0.000039 0.000085 -0.000172 0.000154 0.002260 0.000040 0.000090 -0.000163 0.000164 0.002258 0.000040 0.000085 -0.000168 0.000143 0.002755 0.000039 0.000086 -0.000178 0.000155 0.002202 0.000039 0.000075 -0.000164 0.000153 0.002267 0.000038 0.000081 -0.000161 0.000154 0.002158 0.000036 0.000090 -0.000169 0.000158 0.002454 0.000037 0.000061 -0.000162 0.000154 0.002543 0.000038 0.000091 -0.000170 0.000154 0.002168 0.000037 0.000085 -0.000166 0.000151 0.002852 0.000038 0.000087 -0.000167 0.000165 0.002484 0.000039 0.000089 -0.000374 0.000197 0.002217 0.000038 0.000082 -0.000156 0.000150 0.002213 0.000038 0.000112 -0.000683 0.000155 0.002131 0.000038 0.000077 -0.000162 0.000164 0.002199 0.000038 0.000076 -0.000176 0.000154 0.002345 0.000038 0.000089 -0.000175 0.000150 0.002928 0.000039 0.000082 -0.000161 0.000140 0.002528 0.000039 0.000066 -0.000159 0.000151 0.002256 0.000039 0.000075 -0.000155 0.000156 0.002233 0.000040 0.000066 -0.000171 0.000156 0.002149 0.000066 0.000084 -0.000182 0.000154 0.002233 0.000037 0.000117 -0.000166 0.000160 0.002460 0.000037 0.000088 -0.000159 0.000165 0.002891 0.000043 0.000075 -0.000169 0.000143 0.002383 0.000038 0.000084 -0.000162 0.000149 0.002313 0.000039 0.000078 -0.000166 0.000161 0.003837 0.000041 0.000092 -0.000166 0.000144 0.002389 0.000038 0.000078 -0.000185 0.000153 0.002548 0.000040 0.000090 -0.000166 0.000152 0.002943 0.000037 0.000063 -0.000147 0.000140 0.002284 0.000038 0.000066 -0.000145 0.000141 0.002555 0.000038 0.000071 -0.000189 0.000143 0.002235 0.000038 0.000359 -0.000149 0.000140 0.002779 0.000053 0.000089 -0.000211 0.000206 0.002744 0.000040 0.000067 -0.000150 0.000144 0.002471 0.000039 0.000065 -0.000151 0.000140 0.002563 0.000040 0.000064 -0.000148 0.000138 0.002305 0.000039 0.000066 -0.000148 0.000141 0.002162 0.000036 0.000060 -0.000182 0.000145 0.002403 0.000042 0.000063 -0.000152 0.000141 0.002311 0.000039 0.000065 -0.000148 0.000180 0.002192 0.000038 0.000065 -0.000149 0.000141 0.002516 0.000039 0.000066 -0.000147 0.000142 0.002193 0.000040 0.000064 -0.000146 0.000138 0.002194 0.000036 0.000060 -0.000197 0.000142 0.002291 0.000038 0.000063 -0.000148 0.000142 0.002440 0.000039 0.000066 -0.000148 0.000143 0.002228 0.000039 0.000066 -0.000149 0.000140 0.002216 0.000038 0.000067 -0.000148 0.000145 0.002196 0.000038 0.000066 -0.000148 0.000141 0.002157 0.000036 0.000061 -0.000144 0.000175 0.002491 0.000039 0.000063 -0.000147 0.000141 0.002290 0.000039 0.000066 -0.000149 0.000143 0.002508 0.000039 0.000067 -0.000149 0.000142 0.002536 0.000039 0.000067 -0.000150 0.000141 0.003132 0.000046 0.000070 -0.000153 0.000145 0.002202 0.000039 0.000067 -0.000149 0.000143 0.002102 0.000037 0.000067 -0.000989 0.000142 0.002188 0.000063 0.000068 -0.000151 0.000142 0.002229 0.000038 0.000068 -0.001481 0.000141 0.002238 0.000039 0.000070 -0.000148 0.000142 0.002204 0.000037 0.000093 -0.000160 0.000141 0.002138 0.000038 0.000062 -0.000145 0.000141 0.002708 0.000039 0.000065 -0.000147 0.000142 0.002218 0.000039 0.000067 -0.000148 0.000140 0.002759 0.000038 0.000066 -0.000148 0.000139 0.003156 0.000037 0.000067 -0.000185 0.000141 0.002259 0.000040 0.000066 -0.000148 0.000142 0.002226 0.000047 0.000068 -0.000148 0.000142 0.002305 0.000040 0.000090 -0.001000 0.000155 0.002217 0.000064 0.000068 -0.000154 0.000144 0.002554 0.000038 0.000065 -0.000148 0.000141 0.002151 0.000038 0.000066 -0.000146 0.000181 0.003031 0.000039 0.000062 -0.000146 0.000180 0.002254 0.000039 0.000061 -0.000147 0.000143 0.002188 0.000039 0.000065 -0.000147 0.000140 0.002259 0.000039 0.000063 -0.000146 0.000141 0.002238 0.000038 0.000076 -0.000148 0.000141 0.002163 0.000038 0.000061 -0.000153 0.000143 0.002195 0.000043 0.000072 -0.000149 0.000177 0.003291 0.000039 0.000063 -0.000258 0.000153 0.002150 0.000039 0.000066 -0.000157 0.000144 0.002155 0.000037 0.000060 -0.000160 0.001194 0.002269 0.000040 0.000100 -0.000164 0.000151 0.002162 0.000038 0.000078 -0.000163 0.000424 0.002178 0.000036 0.000069 -0.001333 0.000389 0.002249 0.000039 0.000066 -0.000175 0.000142 0.002208 0.000037 0.000102 -0.000443 0.000156 0.002249 0.000040 0.000062 -0.000244 0.001562 0.003049 0.000041 0.000083 -0.000208 0.000183 0.002483 0.000040 0.000068 -0.000164 0.000156 0.002220 0.000040 0.000078 -0.000169 0.000142 0.002694 0.000040 0.000083 -0.000162 0.000152 0.002453 0.000038 0.000077 -0.000157 0.000189 0.002306 0.000040 0.000077 -0.000162 0.000151 0.002200 0.000039 0.000325 -0.000150 0.000142 0.002251 0.000039 0.000066 -0.000172 0.000157 0.002184 0.000039 0.000073 -0.000160 0.000150 0.002678 0.000038 0.000326 -0.000165 0.000151 0.002292 0.000038 0.000094 -0.000162 0.000156 0.002203 0.000037 0.000083 -0.000170 0.000141 0.002175 0.000037 0.000074 -0.000149 0.000166 0.002235 0.000039 0.000071 -0.000161 0.000143 0.002423 0.000036 0.000180 -0.000164 0.000152 0.003095 0.000039 0.000076 -0.000172 0.000153 0.002466 0.000039 0.000115 -0.000151 0.000153 0.002274 0.000039 0.000066 -0.000150 0.000142 0.003179 0.000040 0.000080 -0.000172 0.000159 0.002421 0.000039 0.000083 -0.000159 0.000142 0.002165 0.000037 0.000068 -0.000155 0.000150 0.002233 0.000041 0.000123 -0.000153 0.000158 0.002253 0.000039 0.000571 -0.000203 0.000145 0.002269 0.000041 0.000077 -0.000164 0.000158 0.002176 0.000038 0.000086 -0.000197 0.000144 0.002220 0.000041 0.000080 -0.000174 0.000403 0.002224 0.000039 0.000063 -0.000218 0.000144 0.002150 0.000036 0.000069 -0.000149 0.000141 0.002479 0.000040 0.000079 -0.000163 0.000145 0.002664 0.000039 0.000082 -0.000150 0.000152 0.002446 0.000040 0.000069 -0.000203 0.000154 0.002205 0.000043 0.000077 -0.000160 0.000143 0.002210 0.000039 0.000087 -0.000194 0.000145 0.002167 0.000038 0.000069 -0.000151 0.000154 0.002137 0.000036 0.000079 -0.000162 0.000140 0.002697 0.000037 0.000085 -0.000162 0.000143 0.002233 0.000039 0.000076 -0.000148 0.000144 0.002210 0.000039 0.000065 -0.000151 0.000152 0.003015 0.000041 0.000084 -0.000158 0.000156 0.002730 0.000039 0.000079 -0.000312 0.000165 0.002207 0.000038 0.000076 -0.000167 0.000139 0.002297 0.000040 0.000065 -0.000172 0.000154 0.002205 0.000037 0.000080 -0.000146 0.000149 0.002286 0.000039 0.000076 -0.000164 0.000151 0.002214 0.000038 0.000073 -0.000162 0.000169 0.003110 0.000038 0.000067 -0.000293 0.000144 0.002182 0.000038 0.000060 -0.000157 0.000153 0.003778 0.000049 0.000095 -0.001735 0.000210 0.004360 0.000050 0.000083 -0.000297 0.000198 0.002532 0.000039 0.000072 -0.000185 0.000163 0.002173 0.000039 0.000070 -0.000183 0.000142 0.002122 0.000038 0.000062 -0.000147 0.000145 0.002443 0.000039 0.000066 -0.000149 0.000144 0.002473 0.000040 0.000066 -0.000147 0.000139 0.002949 0.000038 0.000063 -0.000147 0.000139 0.002737 0.000039 0.000066 -0.000199 0.000142 0.002927 0.000038 0.000066 -0.000149 0.000141 0.002188 0.000038 0.000065 -0.000147 0.000144 0.002203 0.000038 0.000066 -0.000149 0.000141 0.002154 0.000037 0.000062 -0.000144 0.000137 0.003526 0.000037 0.000066 -0.000151 0.000153 0.002150 0.000036 0.000060 -0.000145 0.000138 0.002202 0.000037 0.000065 -0.000272 0.000187 0.002477 0.000038 0.000306 -0.000148 0.000141 0.002421 0.000038 0.000067 -0.000147 0.000141 0.002252 0.000039 0.000065 -0.000150 0.000140 0.002144 0.000037 0.000061 -0.000191 0.000144 0.002229 0.000038 0.000060 -0.000145 0.000145 0.002202 0.000038 0.000061 -0.000146 0.000142 0.002418 0.000038 0.000065 -0.000189 0.000171 0.002568 0.000040 0.000066 -0.000150 0.000141 0.002300 0.000039 0.000067 -0.000151 0.000141 0.002199 0.000038 0.000347 -0.000147 0.000140 0.002165 0.000035 0.000061 -0.000151 0.000646 0.002310 0.000040 0.000062 -0.000161 0.000410 0.002195 0.000038 0.000061 -0.000147 0.000141 0.002466 0.000039 0.000066 -0.000147 0.000141 0.003026 0.000038 0.000066 -0.000148 0.000142 0.002223 0.000038 0.000065 -0.000147 0.000142 0.002196 0.000038 0.000067 -0.000147 0.000141 0.002155 0.000044 0.000064 -0.000146 0.000140 0.002354 0.000039 0.000067 -0.000149 0.000143 0.002186 0.000037 0.000062 -0.000150 0.000144 0.002498 0.000040 0.000063 -0.000178 0.000212 0.002453 0.000039 0.000062 -0.000149 0.000177 0.002463 0.000038 0.000063 -0.000147 0.000142 0.002507 0.000038 0.000067 -0.000149 0.000142 0.002717 0.000038 0.000066 -0.000148 0.000141 0.002452 0.000037 0.000065 -0.000147 0.000140 0.002266 0.000039 0.000066 -0.000149 0.000141 0.002183 0.000037 0.000066 -0.000153 0.000142 0.002203 0.000039 0.000067 -0.000152 0.000419 0.002245 0.000040 0.000062 -0.000149 0.000181 0.002181 0.000038 0.000063 -0.000147 0.000142 0.002224 0.000039 0.000066 -0.000147 0.000142 0.002204 0.000038 0.000066 -0.000146 0.000141 0.002250 0.000038 0.000065 -0.000148 0.000141 0.002142 0.000038 0.000063 -0.000156 0.000139 0.002176 0.000036 0.000060 -0.000243 0.000148 0.002768 0.000039 0.000069 -0.000146 0.000204 0.002194 0.000037 0.000065 -0.000147 0.000143 0.003071 0.000039 0.000066 -0.000148 0.000144 0.003489 0.000042 0.000073 -0.000151 0.000151 0.002173 0.000039 0.000064 -0.000146 0.000140 0.003509 0.000038 0.000067 -0.000148 0.000142 0.002191 0.000038 0.000064 -0.000146 0.000139 0.002441 0.000039 0.000117 -0.000174 0.000141 0.002133 0.000038 0.000065 -0.000151 0.000142 0.002257 0.000039 0.000073 -0.000163 0.000147 0.002187 0.000038 0.000061 -0.000146 0.000222 0.002193 0.000038 0.000062 -0.000145 0.000143 0.002434 0.000037 0.000064 -0.000145 0.000139 0.002933 0.000041 0.000066 -0.000146 0.000140 0.002680 0.000037 0.000065 -0.000143 0.000139 0.002217 0.001029 0.000065 -0.000145 0.000139 0.002361 0.000039 0.000067 -0.000150 0.000143 0.002186 0.000068 0.000066 -0.000148 0.000142 0.002149 0.000037 0.000061 -0.000147 0.000181 0.002183 0.000037 0.000061 -0.000146 0.000455 0.002305 0.000038 0.000074 -0.000148 0.000143 0.002223 0.000038 0.000066 -0.000148 0.000141 0.002547 0.000038 0.000066 -0.000148 0.000143 0.002180 0.000038 0.000336 -0.000146 0.000141 0.002102 0.000037 0.000063 -0.000150 0.000145 0.002170 0.000037 0.000067 -0.000152 0.000138 0.002982 0.000038 0.000067 -0.000149 0.000143 0.002419 0.000037 0.000064 -0.000145 0.000195 0.002228 0.000040 0.000067 -0.000148 0.000143 0.002193 0.000038 0.000064 -0.000155 0.000141 0.002166 0.000067 0.000066 -0.000454 0.000176 0.002193 0.000038 0.000063 -0.000186 0.000142 0.002165 0.000035 0.000066 -0.000144 0.000138 0.002542 0.000038 0.000066 -0.000148 0.000143 0.002733 0.000039 0.000066 -0.000147 0.000141 0.002227 0.000038 0.000067 -0.000145 0.000142 0.002764 0.000037 0.000064 -0.000144 0.000138 0.002207 0.000037 0.000065 -0.000147 0.000185 0.002262 0.000038 0.000062 -0.000154 0.000160 0.002163 0.000038 0.000063 -0.000150 0.000145 0.002719 0.000038 0.000065 -0.000145 0.000139 0.002226 0.000037 0.000074 -0.000148 0.000140 0.002517 0.000038 0.000067 -0.000148 0.000142 0.003734 0.000039 0.000067 -0.000147 0.000143 0.002508 0.000039 0.000067 -0.000146 0.000143 0.002288 0.000038 0.000067 -0.000149 0.000143 0.002899 0.000039 0.000067 -0.000150 0.000145 0.002232 0.000037 0.000065 -0.000148 0.000142 0.002169 0.000039 0.000067 -0.000161 0.000141 0.002196 0.000036 0.000060 -0.000145 0.000137 0.002467 0.000040 0.000064 -0.000147 0.000141 0.002168 0.000037 0.000063 -0.000147 0.000139 0.002165 0.000037 0.000064 -0.000146 0.000138 0.002167 0.000036 0.000060 -0.000150 0.000141 0.002326 0.000039 0.000063 -0.000149 0.000179 0.002197 0.000039 0.000063 -0.000148 0.000142 0.002538 0.000039 0.000067 -0.000148 0.000148 0.002555 0.000039 0.000067 -0.000150 0.000144 0.002180 0.000038 0.000066 -0.000245 0.000152 0.002203 0.000038 0.000065 -0.000146 0.000142 0.002118 0.000036 0.000091 -0.000648 0.000141 0.002173 0.000035 0.000058 -0.000142 0.000149 0.002137 0.000037 0.000059 -0.000144 0.000138 0.002191 0.000037 0.000063 -0.000143 0.000137 0.002795 0.000039 0.000065 -0.000147 0.000256 0.002250 0.000038 0.000064 -0.000148 0.000142 0.002231 0.000040 0.000075 -0.000149 0.000143 0.002174 0.000038 0.000061 -0.000182 0.000708 0.002255 0.000038 0.000061 -0.000181 0.000170 0.002222 0.000038 0.000060 -0.000148 0.000141 0.002177 0.000038 0.000065 -0.000147 0.000141 0.002478 0.000039 0.000065 -0.000148 0.000141 0.002191 0.000039 0.000065 -0.000146 0.000139 0.002161 0.000067 0.000063 -0.000157 0.000138 0.002174 0.000036 0.000059 -0.000143 0.000165 0.002396 0.000040 0.000067 -0.000148 0.000141 0.002302 0.000044 0.000067 -0.000148 0.000142 0.002226 0.000043 0.000065 -0.000149 0.000142 0.002198 0.000038 0.000087 -0.000147 0.000143 0.002221 0.000039 0.000066 -0.000146 0.000142 0.002376 0.000065 0.000063 -0.000152 0.000154 0.002201 0.000038 0.000062 -0.000150 0.000142 0.002705 0.000039 0.000067 -0.000149 0.000142 0.002267 0.000039 0.000067 -0.000194 0.000149 0.002347 0.000039 0.000066 -0.000155 0.000141 0.002594 0.000038 0.000066 -0.000148 0.000141 0.002189 0.000038 0.000064 -0.000202 0.000142 0.002155 0.000039 0.000062 -0.000182 0.000146 0.002204 0.000037 0.000061 -0.000146 0.000139 0.002466 0.000037 0.000065 -0.000146 0.000140 0.002463 0.000036 0.000065 -0.000146 0.000139 0.002209 0.000037 0.000063 -0.000145 0.000138 0.002146 0.000036 0.000060 -0.000181 0.000142 0.003356 0.000038 0.000068 -0.000161 0.000142 0.002169 0.000038 0.000062 -0.000146 0.000175 0.002538 0.000039 0.000061 -0.000148 0.000141 0.002482 0.000039 0.000067 -0.000148 0.000144 0.002450 0.000040 0.000066 -0.000149 0.000143 0.002466 0.000043 0.000068 -0.000148 0.000144 0.003551 0.000038 0.000068 -0.000149 0.000142 0.002482 0.000039 0.000066 -0.000149 0.000142 0.002220 0.000039 0.000066 -0.000151 0.000140 0.002199 0.000038 0.000064 -0.000148 0.000184 0.002185 0.000038 0.000066 -0.000145 0.000140 0.002158 0.000036 0.000092 -0.000158 0.000140 0.002262 0.000038 0.000062 -0.000148 0.000143 0.002674 0.000039 0.000066 -0.000148 0.000140 0.002421 0.000039 0.000066 -0.000149 0.000149 0.002433 0.000038 0.000065 -0.000146 0.000172 0.002187 0.000038 0.000065 -0.000146 0.000140 0.002311 0.000039 0.000323 -0.000149 0.000142 0.002180 0.000038 0.000091 -0.000420 0.000143 0.002483 0.000038 0.000063 -0.000685 0.000145 0.002136 0.000035 0.000064 -0.000146 0.000145 0.002433 0.000038 0.000062 -0.000146 0.000139 0.002496 0.000039 0.000066 -0.000149 0.000139 0.003626 0.000041 0.000068 -0.000153 0.000147 0.002272 0.000042 0.000067 -0.000248 0.000155 0.002208 0.000038 0.000063 -0.000146 0.000138 0.002524 0.000038 0.000068 -0.000147 0.000140 0.002176 0.000210 0.000065 -0.000147 0.000140 0.002166 0.000036 0.000060 -0.000144 0.000146 0.002169 0.000036 0.000057 -0.000144 0.000138 0.002207 0.000037 0.000063 -0.000145 0.000138 0.002183 0.000037 0.000062 -0.000145 0.000137 0.002167 0.000036 0.000059 -0.000148 0.000453 0.002310 0.000038 0.000061 -0.000183 0.000855 0.002326 0.000037 0.000061 -0.000146 0.000175 0.002672 0.000036 0.000060 -0.000143 0.000140 0.002238 0.000039 0.000065 -0.000146 0.000139 0.002473 0.000037 0.000064 -0.000146 0.000139 0.002196 0.000039 0.000065 -0.000145 0.000139 0.002141 0.000036 0.000061 -0.000174 0.000397 0.002175 0.000036 0.000059 -0.000143 0.000139 0.002647 0.000037 0.000065 -0.000147 0.000138 0.002196 0.000037 0.000064 -0.000146 0.000138 0.002199 0.000037 0.000063 -0.000146 0.000138 0.002167 0.000036 0.000066 -0.000169 0.000141 0.002156 0.000036 0.000060 -0.000143 0.000139 0.002180 0.000037 0.000065 -0.000144 0.000136 0.002756 0.000039 0.000066 -0.000150 0.000141 0.002919 0.000039 0.000066 -0.000147 0.000140 0.002184 0.000036 0.000065 -0.000145 0.000138 0.002168 0.000036 0.000091 -0.000156 0.000139 0.002169 0.000036 0.000059 -0.000143 0.000139 0.002741 0.000038 0.000065 -0.000147 0.000140 0.002429 0.000037 0.000063 -0.000145 0.000139 0.002226 0.000037 0.000064 -0.000145 0.000139 0.003381 0.000040 0.000066 -0.000153 0.000141 0.002262 0.000038 0.000064 -0.000145 0.000140 0.002137 0.000036 0.000062 -0.000154 0.000650 0.002217 0.000038 0.000063 -0.000184 0.000143 0.002209 0.000038 0.000062 -0.000153 0.000142 0.002907 0.000039 0.000066 -0.000147 0.000142 0.002158 0.000038 0.000064 -0.000146 0.000140 0.002953 0.000039 0.000068 -0.000148 0.000143 0.002208 0.000039 0.000065 -0.000149 0.000139 0.002187 0.000036 0.000065 -0.000144 0.000139 0.002157 0.000036 0.000061 -0.000154 0.000926 0.002139 0.000036 0.000059 -0.000183 0.000140 0.002526 0.000038 0.000062 -0.000148 0.000142 0.002207 0.000038 0.000066 -0.000147 0.000139 0.002790 0.000039 0.000069 -0.000149 0.000144 0.002251 0.000038 0.000066 -0.000151 0.000140 0.002220 0.000039 0.000066 -0.000148 0.000142 0.002523 0.000038 0.000064 -0.000151 0.000138 0.002151 0.000037 0.000065 -0.000147 0.000140 0.002251 0.000037 0.000062 -0.000149 0.000139 0.002607 0.000037 0.000065 -0.000147 0.000141 0.003380 0.000037 0.000066 -0.000147 0.000139 0.002285 0.000069 0.000066 -0.000149 0.000142 0.002566 0.000038 0.000067 -0.000147 0.000142 0.002523 0.000038 0.000067 -0.000152 0.000143 0.002215 0.000038 0.000067 -0.000150 0.000144 0.002243 0.000038 0.000075 -0.000149 0.000141 0.002148 0.000036 0.000063 -0.000182 0.000144 0.002167 0.000036 0.000062 -0.000278 0.000155 0.002631 0.000036 0.000061 -0.000149 0.000139 0.003175 0.000040 0.000066 -0.000156 0.000140 0.002660 0.000038 0.000065 -0.000148 0.000141 0.006171 0.000067 0.000069 -0.000164 0.000142 0.002713 0.000038 0.000064 -0.000161 0.000150 0.002270 0.000038 0.000081 -0.000160 0.000283 0.002276 0.000038 0.000083 -0.000168 0.000150 0.002207 0.000037 0.000072 -0.000151 0.000669 0.002160 0.000038 0.000062 -0.000196 0.000156 0.002363 0.000036 0.000061 -0.000162 0.000141 0.002160 0.000037 0.000077 -0.000147 0.000141 0.002676 0.000038 0.000096 -0.000162 0.000143 0.002263 0.000037 0.000065 -0.000162 0.000141 0.002206 0.000036 0.000080 -0.000146 0.000139 0.002149 0.000036 0.000060 -0.000169 0.000884 0.002163 0.000036 0.000076 -0.000187 0.000140 0.002222 0.000036 0.000061 -0.000145 0.000140 0.002192 0.000037 0.000084 -0.000145 0.000138 0.002619 0.000039 0.000116 -0.000158 0.000149 0.002213 0.000038 0.000089 -0.000145 0.000183 0.002154 0.000038 0.000089 -0.000162 0.000142 0.002142 0.000037 0.000061 -0.000146 0.000178 0.002401 0.000038 0.000062 -0.000145 0.000150 0.002741 0.000037 0.000081 -0.000147 0.000139 0.002360 0.000040 0.000067 -0.000151 0.000153 0.002459 0.000039 0.000075 -0.000148 0.000155 0.002459 0.000037 0.000091 -0.000153 0.000152 0.002174 0.000036 0.000064 -0.000424 0.000149 0.002116 0.000036 0.000068 -0.000166 0.000168 0.002625 0.000038 0.000076 -0.000146 0.000141 0.002957 0.000038 0.000067 -0.000160 0.000142 0.002501 0.000039 0.000079 -0.000147 0.000143 0.002219 0.000038 0.000066 -0.000160 0.000143 0.002771 0.000040 0.000079 -0.000148 0.000150 0.002426 0.000037 0.000082 -0.000146 0.000138 0.002134 0.000036 0.000103 -0.000659 0.000143 0.002197 0.000036 0.000073 -0.000179 0.000153 0.002301 0.000038 0.000074 -0.000147 0.000142 0.002258 0.000038 0.000066 -0.000146 0.000141 0.002210 0.000038 0.000066 -0.000161 0.000141 0.002235 0.000038 0.000084 -0.000145 0.000138 0.002131 0.000036 0.000060 -0.000151 0.000211 0.002265 0.000038 0.000062 -0.000147 0.000142 0.002254 0.000038 0.000067 -0.000148 0.000143 0.002217 0.000038 0.000079 -0.000160 0.000155 0.002229 0.000038 0.000066 -0.000145 0.000142 0.002129 0.000038 0.000065 -0.000165 0.000140 0.002140 0.000036 0.000076 -0.000162 0.000142 0.002452 0.000039 0.000079 -0.000148 0.000143 0.002253 0.000059 0.000068 -0.000164 0.000142 0.003378 0.000039 0.000096 -0.000150 0.000194 0.002192 0.000039 0.000067 -0.000161 0.000152 0.002202 0.000037 0.000077 -0.000160 0.000141 0.002258 0.000039 0.000067 -0.000167 0.000143 0.002706 0.000039 0.000067 -0.000149 0.000155 0.002280 0.000037 0.000100 -0.000174 0.000144 0.002134 0.000037 0.000090 -0.001167 0.000154 0.002224 0.000038 0.000067 -0.000162 0.000155 0.002181 0.000035 0.000065 -0.000773 0.000153 0.002145 0.000036 0.000060 -0.000149 0.000161 0.002160 0.000036 0.000071 -0.000208 0.000144 0.002164 0.000035 0.000060 -0.000143 0.000138 0.002156 0.000036 0.000064 -0.000143 0.000138 0.002225 0.000055 0.000066 -0.000147 0.000141 0.002734 0.000038 0.000065 -0.000145 0.000147 0.002173 0.000037 0.000064 -0.000146 0.000139 0.002112 0.000037 0.000060 -0.000144 0.000137 0.002708 0.000038 0.000064 -0.000144 0.000139 0.002421 0.000037 0.000064 -0.000145 0.000140 0.002449 0.000037 0.000063 -0.000143 0.000138 0.002278 0.000038 0.000064 -0.000145 0.000140 0.002427 0.000040 0.000130 -0.000151 0.000142 0.002155 0.000036 0.000064 -0.000181 0.000139 0.002435 0.000036 0.000060 -0.000145 0.000138 0.003527 0.000038 0.000065 -0.000146 0.000178 0.002178 0.000036 0.000060 -0.000145 0.000138 0.002139 0.000037 0.000065 -0.000145 0.000137 0.003006 0.000037 0.000064 -0.000146 0.000139 0.002204 0.000037 0.000065 -0.000145 0.000139 0.002211 0.000038 0.000062 -0.000182 0.000140 0.002221 0.000036 0.000061 -0.000145 0.000139 0.003169 0.000038 0.000068 -0.000149 0.000174 0.002414 0.000038 0.000066 -0.000147 0.000142 0.002234 0.000038 0.000066 -0.000149 0.000143 0.002678 0.000038 0.000065 -0.000148 0.000141 0.002886 0.000038 0.000066 -0.000145 0.000140 0.002250 0.000038 0.000065 -0.000148 0.000139 0.002181 0.000035 0.000065 -0.000718 0.000142 0.002141 0.000035 0.000059 -0.000189 0.000140 0.002383 0.000036 0.000059 -0.000145 0.000139 0.002206 0.000039 0.000065 -0.000154 0.000186 0.002457 0.000038 0.000066 -0.000190 0.000141 0.002224 0.000038 0.000066 -0.000149 0.000141 0.002151 0.000037 0.000066 -0.000215 0.000143 0.002151 0.000035 0.000061 -0.000144 0.000138 0.002822 0.000039 0.000065 -0.000147 0.000139 0.002275 0.000038 0.000065 -0.000148 0.000141 0.002211 0.000036 0.000064 -0.000146 0.000138 0.002201 0.000037 0.000066 -0.000148 0.000140 0.002273 0.000038 0.000068 -0.000150 0.000144 0.002188 0.000037 0.000063 -0.000152 0.000151 0.002190 0.000037 0.000062 -0.000146 0.000142 0.003145 0.000039 0.000067 -0.000151 0.000139 0.002218 0.000037 0.000065 -0.000145 0.000138 0.002264 0.000037 0.000066 -0.000148 0.000142 0.003011 0.000039 0.000067 -0.000149 0.000141 0.002196 0.000038 0.000065 -0.000146 0.000141 0.002188 0.000036 0.000060 -0.000149 0.000140 0.002190 0.000035 0.000060 -0.000144 0.000137 0.002641 0.000038 0.000064 -0.000146 0.000138 0.002182 0.000043 0.000065 -0.000146 0.000141 0.002216 0.000036 0.000064 -0.000147 0.000139 0.002294 0.000039 0.000068 -0.000657 0.000145 0.002143 0.000037 0.000062 -0.000154 0.000415 0.002237 0.000040 0.000084 diff --git a/assets/dropbox-sync/dropbox-spaces.png b/assets/dropbox-sync/dropbox-spaces.png deleted file mode 100644 index c90f99f..0000000 Binary files a/assets/dropbox-sync/dropbox-spaces.png and /dev/null differ diff --git a/assets/esp8366-micropython/boards.jpg b/assets/esp8366-micropython/boards.jpg deleted file mode 100644 index 89e2b30..0000000 Binary files a/assets/esp8366-micropython/boards.jpg and /dev/null differ diff --git a/assets/general/alert-dark.svg b/assets/general/alert-dark.svg deleted file mode 100644 index d453564..0000000 --- a/assets/general/alert-dark.svg +++ /dev/null @@ -1,99 +0,0 @@ - - - -image/svg+xml - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - diff --git a/assets/general/alert-light.svg b/assets/general/alert-light.svg deleted file mode 100644 index 86658ec..0000000 --- a/assets/general/alert-light.svg +++ /dev/null @@ -1,99 +0,0 @@ - - - -image/svg+xml - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - \ No newline at end of file diff --git a/assets/general/elasticlunr.min.js b/assets/general/elasticlunr.min.js deleted file mode 100644 index 94b20dd..0000000 --- a/assets/general/elasticlunr.min.js +++ /dev/null @@ -1,10 +0,0 @@ -/** - * elasticlunr - http://weixsong.github.io - * Lightweight full-text search engine in Javascript for browser search and offline search. - 0.9.5 - * - * Copyright (C) 2017 Oliver Nightingale - * Copyright (C) 2017 Wei Song - * MIT Licensed - * @license - */ -!function(){function e(e){if(null===e||"object"!=typeof e)return e;var t=e.constructor();for(var n in e)e.hasOwnProperty(n)&&(t[n]=e[n]);return t}var t=function(e){var n=new t.Index;return n.pipeline.add(t.trimmer,t.stopWordFilter,t.stemmer),e&&e.call(n,n),n};t.version="0.9.5",lunr=t,t.utils={},t.utils.warn=function(e){return function(t){e.console&&console.warn&&console.warn(t)}}(this),t.utils.toString=function(e){return void 0===e||null===e?"":e.toString()},t.EventEmitter=function(){this.events={}},t.EventEmitter.prototype.addListener=function(){var e=Array.prototype.slice.call(arguments),t=e.pop(),n=e;if("function"!=typeof t)throw new TypeError("last argument must be a function");n.forEach(function(e){this.hasHandler(e)||(this.events[e]=[]),this.events[e].push(t)},this)},t.EventEmitter.prototype.removeListener=function(e,t){if(this.hasHandler(e)){var n=this.events[e].indexOf(t);-1!==n&&(this.events[e].splice(n,1),0==this.events[e].length&&delete this.events[e])}},t.EventEmitter.prototype.emit=function(e){if(this.hasHandler(e)){var t=Array.prototype.slice.call(arguments,1);this.events[e].forEach(function(e){e.apply(void 0,t)},this)}},t.EventEmitter.prototype.hasHandler=function(e){return e in this.events},t.tokenizer=function(e){if(!arguments.length||null===e||void 0===e)return[];if(Array.isArray(e)){var n=e.filter(function(e){return null===e||void 0===e?!1:!0});n=n.map(function(e){return t.utils.toString(e).toLowerCase()});var i=[];return n.forEach(function(e){var n=e.split(t.tokenizer.seperator);i=i.concat(n)},this),i}return e.toString().trim().toLowerCase().split(t.tokenizer.seperator)},t.tokenizer.defaultSeperator=/[\s\-]+/,t.tokenizer.seperator=t.tokenizer.defaultSeperator,t.tokenizer.setSeperator=function(e){null!==e&&void 0!==e&&"object"==typeof e&&(t.tokenizer.seperator=e)},t.tokenizer.resetSeperator=function(){t.tokenizer.seperator=t.tokenizer.defaultSeperator},t.tokenizer.getSeperator=function(){return t.tokenizer.seperator},t.Pipeline=function(){this._queue=[]},t.Pipeline.registeredFunctions={},t.Pipeline.registerFunction=function(e,n){n in t.Pipeline.registeredFunctions&&t.utils.warn("Overwriting existing registered function: "+n),e.label=n,t.Pipeline.registeredFunctions[n]=e},t.Pipeline.getRegisteredFunction=function(e){return e in t.Pipeline.registeredFunctions!=!0?null:t.Pipeline.registeredFunctions[e]},t.Pipeline.warnIfFunctionNotRegistered=function(e){var n=e.label&&e.label in this.registeredFunctions;n||t.utils.warn("Function is not registered with pipeline. This may cause problems when serialising the index.\n",e)},t.Pipeline.load=function(e){var n=new t.Pipeline;return e.forEach(function(e){var i=t.Pipeline.getRegisteredFunction(e);if(!i)throw new Error("Cannot load un-registered function: "+e);n.add(i)}),n},t.Pipeline.prototype.add=function(){var e=Array.prototype.slice.call(arguments);e.forEach(function(e){t.Pipeline.warnIfFunctionNotRegistered(e),this._queue.push(e)},this)},t.Pipeline.prototype.after=function(e,n){t.Pipeline.warnIfFunctionNotRegistered(n);var i=this._queue.indexOf(e);if(-1===i)throw new Error("Cannot find existingFn");this._queue.splice(i+1,0,n)},t.Pipeline.prototype.before=function(e,n){t.Pipeline.warnIfFunctionNotRegistered(n);var i=this._queue.indexOf(e);if(-1===i)throw new Error("Cannot find existingFn");this._queue.splice(i,0,n)},t.Pipeline.prototype.remove=function(e){var t=this._queue.indexOf(e);-1!==t&&this._queue.splice(t,1)},t.Pipeline.prototype.run=function(e){for(var t=[],n=e.length,i=this._queue.length,o=0;n>o;o++){for(var r=e[o],s=0;i>s&&(r=this._queue[s](r,o,e),void 0!==r&&null!==r);s++);void 0!==r&&null!==r&&t.push(r)}return t},t.Pipeline.prototype.reset=function(){this._queue=[]},t.Pipeline.prototype.get=function(){return this._queue},t.Pipeline.prototype.toJSON=function(){return this._queue.map(function(e){return t.Pipeline.warnIfFunctionNotRegistered(e),e.label})},t.Index=function(){this._fields=[],this._ref="id",this.pipeline=new t.Pipeline,this.documentStore=new t.DocumentStore,this.index={},this.eventEmitter=new t.EventEmitter,this._idfCache={},this.on("add","remove","update",function(){this._idfCache={}}.bind(this))},t.Index.prototype.on=function(){var e=Array.prototype.slice.call(arguments);return this.eventEmitter.addListener.apply(this.eventEmitter,e)},t.Index.prototype.off=function(e,t){return this.eventEmitter.removeListener(e,t)},t.Index.load=function(e){e.version!==t.version&&t.utils.warn("version mismatch: current "+t.version+" importing "+e.version);var n=new this;n._fields=e.fields,n._ref=e.ref,n.documentStore=t.DocumentStore.load(e.documentStore),n.pipeline=t.Pipeline.load(e.pipeline),n.index={};for(var i in e.index)n.index[i]=t.InvertedIndex.load(e.index[i]);return n},t.Index.prototype.addField=function(e){return this._fields.push(e),this.index[e]=new t.InvertedIndex,this},t.Index.prototype.setRef=function(e){return this._ref=e,this},t.Index.prototype.saveDocument=function(e){return this.documentStore=new t.DocumentStore(e),this},t.Index.prototype.addDoc=function(e,n){if(e){var n=void 0===n?!0:n,i=e[this._ref];this.documentStore.addDoc(i,e),this._fields.forEach(function(n){var o=this.pipeline.run(t.tokenizer(e[n]));this.documentStore.addFieldLength(i,n,o.length);var r={};o.forEach(function(e){e in r?r[e]+=1:r[e]=1},this);for(var s in r){var u=r[s];u=Math.sqrt(u),this.index[n].addToken(s,{ref:i,tf:u})}},this),n&&this.eventEmitter.emit("add",e,this)}},t.Index.prototype.removeDocByRef=function(e){if(e&&this.documentStore.isDocStored()!==!1&&this.documentStore.hasDoc(e)){var t=this.documentStore.getDoc(e);this.removeDoc(t,!1)}},t.Index.prototype.removeDoc=function(e,n){if(e){var n=void 0===n?!0:n,i=e[this._ref];this.documentStore.hasDoc(i)&&(this.documentStore.removeDoc(i),this._fields.forEach(function(n){var o=this.pipeline.run(t.tokenizer(e[n]));o.forEach(function(e){this.index[n].removeToken(e,i)},this)},this),n&&this.eventEmitter.emit("remove",e,this))}},t.Index.prototype.updateDoc=function(e,t){var t=void 0===t?!0:t;this.removeDocByRef(e[this._ref],!1),this.addDoc(e,!1),t&&this.eventEmitter.emit("update",e,this)},t.Index.prototype.idf=function(e,t){var n="@"+t+"/"+e;if(Object.prototype.hasOwnProperty.call(this._idfCache,n))return this._idfCache[n];var i=this.index[t].getDocFreq(e),o=1+Math.log(this.documentStore.length/(i+1));return this._idfCache[n]=o,o},t.Index.prototype.getFields=function(){return this._fields.slice()},t.Index.prototype.search=function(e,n){if(!e)return[];e="string"==typeof e?{any:e}:JSON.parse(JSON.stringify(e));var i=null;null!=n&&(i=JSON.stringify(n));for(var o=new t.Configuration(i,this.getFields()).get(),r={},s=Object.keys(e),u=0;u0&&t.push(e);for(var i in n)"docs"!==i&&"df"!==i&&this.expandToken(e+i,t,n[i]);return t},t.InvertedIndex.prototype.toJSON=function(){return{root:this.root}},t.Configuration=function(e,n){var e=e||"";if(void 0==n||null==n)throw new Error("fields should not be null");this.config={};var i;try{i=JSON.parse(e),this.buildUserConfig(i,n)}catch(o){t.utils.warn("user configuration parse failed, will use default configuration"),this.buildDefaultConfig(n)}},t.Configuration.prototype.buildDefaultConfig=function(e){this.reset(),e.forEach(function(e){this.config[e]={boost:1,bool:"OR",expand:!1}},this)},t.Configuration.prototype.buildUserConfig=function(e,n){var i="OR",o=!1;if(this.reset(),"bool"in e&&(i=e.bool||i),"expand"in e&&(o=e.expand||o),"fields"in e)for(var r in e.fields)if(n.indexOf(r)>-1){var s=e.fields[r],u=o;void 0!=s.expand&&(u=s.expand),this.config[r]={boost:s.boost||0===s.boost?s.boost:1,bool:s.bool||i,expand:u}}else t.utils.warn("field name in user configuration not found in index instance fields");else this.addAllFields2UserConfig(i,o,n)},t.Configuration.prototype.addAllFields2UserConfig=function(e,t,n){n.forEach(function(n){this.config[n]={boost:1,bool:e,expand:t}},this)},t.Configuration.prototype.get=function(){return this.config},t.Configuration.prototype.reset=function(){this.config={}},lunr.SortedSet=function(){this.length=0,this.elements=[]},lunr.SortedSet.load=function(e){var t=new this;return t.elements=e,t.length=e.length,t},lunr.SortedSet.prototype.add=function(){var e,t;for(e=0;e1;){if(r===e)return o;e>r&&(t=o),r>e&&(n=o),i=n-t,o=t+Math.floor(i/2),r=this.elements[o]}return r===e?o:-1},lunr.SortedSet.prototype.locationFor=function(e){for(var t=0,n=this.elements.length,i=n-t,o=t+Math.floor(i/2),r=this.elements[o];i>1;)e>r&&(t=o),r>e&&(n=o),i=n-t,o=t+Math.floor(i/2),r=this.elements[o];return r>e?o:e>r?o+1:void 0},lunr.SortedSet.prototype.intersect=function(e){for(var t=new lunr.SortedSet,n=0,i=0,o=this.length,r=e.length,s=this.elements,u=e.elements;;){if(n>o-1||i>r-1)break;s[n]!==u[i]?s[n]u[i]&&i++:(t.add(s[n]),n++,i++)}return t},lunr.SortedSet.prototype.clone=function(){var e=new lunr.SortedSet;return e.elements=this.toArray(),e.length=e.elements.length,e},lunr.SortedSet.prototype.union=function(e){var t,n,i;this.length>=e.length?(t=this,n=e):(t=e,n=this),i=t.clone();for(var o=0,r=n.toArray();o -
Database
Database
Web application


[Not supported by viewer]
Write
datapoint
[Not supported by viewer]
Read
datapoints
[Not supported by viewer]
Arduino
MKR1000
[Not supported by viewer]
Web browser
Web browser
Route: /
[Not supported by viewer]
Route: /api
[Not supported by viewer] \ No newline at end of file diff --git a/assets/iot-application/simple-iot-application.zip b/assets/iot-application/simple-iot-application.zip deleted file mode 100644 index 46d3205..0000000 Binary files a/assets/iot-application/simple-iot-application.zip and /dev/null differ diff --git a/assets/iot-application/snakeviz.png b/assets/iot-application/snakeviz.png deleted file mode 100644 index 5bab395..0000000 Binary files a/assets/iot-application/snakeviz.png and /dev/null differ diff --git a/assets/pid1/boxes.mp4 b/assets/pid1/boxes.mp4 deleted file mode 100644 index eb647ff..0000000 Binary files a/assets/pid1/boxes.mp4 and /dev/null differ diff --git a/assets/pid1/qemu.log b/assets/pid1/qemu.log deleted file mode 100644 index 11be312..0000000 --- a/assets/pid1/qemu.log +++ /dev/null @@ -1,320 +0,0 @@ -[ 0.000000] Linux version 5.15.7 (m@khan) (gcc (GCC) 11.2.1 20211203 (Red Hat 11.2.1-7), GNU ld version 2.37-10.fc35) #7 SMP Mon Dec 13 10:23:25 CET 2021 -[ 0.000000] Command line: console=ttyS0 -[ 0.000000] x86/fpu: x87 FPU will use FXSAVE -[ 0.000000] signal: max sigframe size: 1440 -[ 0.000000] BIOS-provided physical RAM map: -[ 0.000000] BIOS-e820: [mem 0x0000000000000000-0x000000000009fbff] usable -[ 0.000000] BIOS-e820: [mem 0x000000000009fc00-0x000000000009ffff] reserved -[ 0.000000] BIOS-e820: [mem 0x00000000000f0000-0x00000000000fffff] reserved -[ 0.000000] BIOS-e820: [mem 0x0000000000100000-0x0000000007fdffff] usable -[ 0.000000] BIOS-e820: [mem 0x0000000007fe0000-0x0000000007ffffff] reserved -[ 0.000000] BIOS-e820: [mem 0x00000000fffc0000-0x00000000ffffffff] reserved -[ 0.000000] NX (Execute Disable) protection: active -[ 0.000000] SMBIOS 2.8 present. -[ 0.000000] DMI: QEMU Standard PC (i440FX + PIIX, 1996), BIOS 1.14.0-6.fc35 04/01/2014 -[ 0.000000] tsc: Fast TSC calibration failed -[ 0.000000] last_pfn = 0x7fe0 max_arch_pfn = 0x400000000 -[ 0.000000] x86/PAT: Configuration [0-7]: WB WC UC- UC WB WP UC- WT -[ 0.000000] found SMP MP-table at [mem 0x000f5c40-0x000f5c4f] -[ 0.000000] RAMDISK: [mem 0x07e06000-0x07fdffff] -[ 0.000000] ACPI: Early table checksum verification disabled -[ 0.000000] ACPI: RSDP 0x00000000000F5A80 000014 (v00 BOCHS ) -[ 0.000000] ACPI: RSDT 0x0000000007FE1905 000034 (v01 BOCHS BXPC 00000001 BXPC 00000001) -[ 0.000000] ACPI: FACP 0x0000000007FE17B9 000074 (v01 BOCHS BXPC 00000001 BXPC 00000001) -[ 0.000000] ACPI: DSDT 0x0000000007FE0040 001779 (v01 BOCHS BXPC 00000001 BXPC 00000001) -[ 0.000000] ACPI: FACS 0x0000000007FE0000 000040 -[ 0.000000] ACPI: APIC 0x0000000007FE182D 000078 (v01 BOCHS BXPC 00000001 BXPC 00000001) -[ 0.000000] ACPI: HPET 0x0000000007FE18A5 000038 (v01 BOCHS BXPC 00000001 BXPC 00000001) -[ 0.000000] ACPI: WAET 0x0000000007FE18DD 000028 (v01 BOCHS BXPC 00000001 BXPC 00000001) -[ 0.000000] ACPI: Reserving FACP table memory at [mem 0x7fe17b9-0x7fe182c] -[ 0.000000] ACPI: Reserving DSDT table memory at [mem 0x7fe0040-0x7fe17b8] -[ 0.000000] ACPI: Reserving FACS table memory at [mem 0x7fe0000-0x7fe003f] -[ 0.000000] ACPI: Reserving APIC table memory at [mem 0x7fe182d-0x7fe18a4] -[ 0.000000] ACPI: Reserving HPET table memory at [mem 0x7fe18a5-0x7fe18dc] -[ 0.000000] ACPI: Reserving WAET table memory at [mem 0x7fe18dd-0x7fe1904] -[ 0.000000] No NUMA configuration found -[ 0.000000] Faking a node at [mem 0x0000000000000000-0x0000000007fdffff] -[ 0.000000] NODE_DATA(0) allocated [mem 0x07e02000-0x07e05fff] -[ 0.000000] Zone ranges: -[ 0.000000] DMA [mem 0x0000000000001000-0x0000000000ffffff] -[ 0.000000] DMA32 [mem 0x0000000001000000-0x0000000007fdffff] -[ 0.000000] Normal empty -[ 0.000000] Movable zone start for each node -[ 0.000000] Early memory node ranges -[ 0.000000] node 0: [mem 0x0000000000001000-0x000000000009efff] -[ 0.000000] node 0: [mem 0x0000000000100000-0x0000000007fdffff] -[ 0.000000] Initmem setup node 0 [mem 0x0000000000001000-0x0000000007fdffff] -[ 0.000000] On node 0, zone DMA: 1 pages in unavailable ranges -[ 0.000000] On node 0, zone DMA: 97 pages in unavailable ranges -[ 0.000000] On node 0, zone DMA32: 32 pages in unavailable ranges -[ 0.000000] ACPI: PM-Timer IO Port: 0x608 -[ 0.000000] ACPI: LAPIC_NMI (acpi_id[0xff] dfl dfl lint[0x1]) -[ 0.000000] IOAPIC[0]: apic_id 0, version 32, address 0xfec00000, GSI 0-23 -[ 0.000000] ACPI: INT_SRC_OVR (bus 0 bus_irq 0 global_irq 2 dfl dfl) -[ 0.000000] ACPI: INT_SRC_OVR (bus 0 bus_irq 5 global_irq 5 high level) -[ 0.000000] ACPI: INT_SRC_OVR (bus 0 bus_irq 9 global_irq 9 high level) -[ 0.000000] ACPI: INT_SRC_OVR (bus 0 bus_irq 10 global_irq 10 high level) -[ 0.000000] ACPI: INT_SRC_OVR (bus 0 bus_irq 11 global_irq 11 high level) -[ 0.000000] ACPI: Using ACPI (MADT) for SMP configuration information -[ 0.000000] ACPI: HPET id: 0x8086a201 base: 0xfed00000 -[ 0.000000] smpboot: Allowing 1 CPUs, 0 hotplug CPUs -[ 0.000000] PM: hibernation: Registered nosave memory: [mem 0x00000000-0x00000fff] -[ 0.000000] PM: hibernation: Registered nosave memory: [mem 0x0009f000-0x0009ffff] -[ 0.000000] PM: hibernation: Registered nosave memory: [mem 0x000a0000-0x000effff] -[ 0.000000] PM: hibernation: Registered nosave memory: [mem 0x000f0000-0x000fffff] -[ 0.000000] [mem 0x08000000-0xfffbffff] available for PCI devices -[ 0.000000] clocksource: refined-jiffies: mask: 0xffffffff max_cycles: 0xffffffff, max_idle_ns: 1910969940391419 ns -[ 0.000000] setup_percpu: NR_CPUS:64 nr_cpumask_bits:64 nr_cpu_ids:1 nr_node_ids:1 -[ 0.000000] percpu: Embedded 52 pages/cpu s174360 r8192 d30440 u2097152 -[ 0.000000] Built 1 zonelists, mobility grouping on. Total pages: 31968 -[ 0.000000] Policy zone: DMA32 -[ 0.000000] Kernel command line: console=ttyS0 -[ 0.000000] Dentry cache hash table entries: 16384 (order: 5, 131072 bytes, linear) -[ 0.000000] Inode-cache hash table entries: 8192 (order: 4, 65536 bytes, linear) -[ 0.000000] mem auto-init: stack:off, heap alloc:off, heap free:off -[ 0.000000] Memory: 94464K/130552K available (14350K kernel code, 2582K rwdata, 3596K rodata, 1368K init, 1488K bss, 35828K reserved, 0K cma-reserved) -[ 0.000000] SLUB: HWalign=64, Order=0-3, MinObjects=0, CPUs=1, Nodes=1 -[ 0.000000] rcu: Hierarchical RCU implementation. -[ 0.000000] rcu: RCU event tracing is enabled. -[ 0.000000] rcu: RCU restricting CPUs from NR_CPUS=64 to nr_cpu_ids=1. -[ 0.000000] rcu: RCU calculated value of scheduler-enlistment delay is 100 jiffies. -[ 0.000000] rcu: Adjusting geometry for rcu_fanout_leaf=16, nr_cpu_ids=1 -[ 0.000000] NR_IRQS: 4352, nr_irqs: 256, preallocated irqs: 16 -[ 0.000000] random: get_random_bytes called from start_kernel+0x492/0x65f with crng_init=0 -[ 0.000000] Console: colour VGA+ 80x25 -[ 0.000000] printk: console [ttyS0] enabled -[ 0.000000] ACPI: Core revision 20210730 -[ 0.000000] clocksource: hpet: mask: 0xffffffff max_cycles: 0xffffffff, max_idle_ns: 19112604467 ns -[ 0.002000] APIC: Switch to symmetric I/O mode setup -[ 0.005000] ..TIMER: vector=0x30 apic1=0 pin1=2 apic2=-1 pin2=-1 -[ 0.013000] tsc: Unable to calibrate against PIT -[ 0.014000] tsc: using HPET reference calibration -[ 0.014000] tsc: Detected 3189.099 MHz processor -[ 0.001005] clocksource: tsc-early: mask: 0xffffffffffffffff max_cycles: 0x2df8103a89b, max_idle_ns: 440795220785 ns -[ 0.002672] Calibrating delay loop (skipped), value calculated using timer frequency.. 6378.19 BogoMIPS (lpj=3189099) -[ 0.002960] pid_max: default: 32768 minimum: 301 -[ 0.003627] LSM: Security Framework initializing -[ 0.004329] SELinux: Initializing. -[ 0.005051] Mount-cache hash table entries: 512 (order: 0, 4096 bytes, linear) -[ 0.005202] Mountpoint-cache hash table entries: 512 (order: 0, 4096 bytes, linear) -[ 0.020479] process: using AMD E400 aware idle routine -[ 0.020699] Last level iTLB entries: 4KB 512, 2MB 255, 4MB 127 -[ 0.020832] Last level dTLB entries: 4KB 512, 2MB 255, 4MB 127, 1GB 0 -[ 0.021165] Spectre V1 : Mitigation: usercopy/swapgs barriers and __user pointer sanitization -[ 0.021438] Spectre V2 : Mitigation: Full AMD retpoline -[ 0.021586] Spectre V2 : Spectre v2 / SpectreRSB mitigation: Filling RSB on context switch -[ 0.238228] Freeing SMP alternatives memory: 44K -[ 0.242641] random: fast init done -[ 0.350203] smpboot: CPU0: AMD QEMU Virtual CPU version 2.5+ (family: 0xf, model: 0x6b, stepping: 0x1) -[ 0.355136] Performance Events: PMU not available due to virtualization, using software events only. -[ 0.356607] rcu: Hierarchical SRCU implementation. -[ 0.360890] smp: Bringing up secondary CPUs ... -[ 0.361082] smp: Brought up 1 node, 1 CPU -[ 0.361253] smpboot: Max logical packages: 1 -[ 0.361394] smpboot: Total of 1 processors activated (6378.19 BogoMIPS) -[ 0.371481] devtmpfs: initialized -[ 0.378162] clocksource: jiffies: mask: 0xffffffff max_cycles: 0xffffffff, max_idle_ns: 1911260446275000 ns -[ 0.378478] futex hash table entries: 256 (order: 2, 16384 bytes, linear) -[ 0.381522] PM: RTC time: 00:19:47, date: 2021-12-27 -[ 0.384915] NET: Registered PF_NETLINK/PF_ROUTE protocol family -[ 0.387403] audit: initializing netlink subsys (disabled) -[ 0.391765] audit: type=2000 audit(1640564386.402:1): state=initialized audit_enabled=0 res=1 -[ 0.392916] thermal_sys: Registered thermal governor 'step_wise' -[ 0.392950] thermal_sys: Registered thermal governor 'user_space' -[ 0.393202] cpuidle: using governor menu -[ 0.394085] ACPI: bus type PCI registered -[ 0.396583] PCI: Using configuration type 1 for base access -[ 0.415012] Kprobes globally optimized -[ 0.416844] HugeTLB registered 2.00 MiB page size, pre-allocated 0 pages -[ 0.420649] cryptomgr_test (20) used greatest stack depth: 15680 bytes left -[ 0.426071] ACPI: Added _OSI(Module Device) -[ 0.426182] ACPI: Added _OSI(Processor Device) -[ 0.426279] ACPI: Added _OSI(3.0 _SCP Extensions) -[ 0.426376] ACPI: Added _OSI(Processor Aggregator Device) -[ 0.426606] ACPI: Added _OSI(Linux-Dell-Video) -[ 0.426709] ACPI: Added _OSI(Linux-Lenovo-NV-HDMI-Audio) -[ 0.426821] ACPI: Added _OSI(Linux-HPI-Hybrid-Graphics) -[ 0.439511] ACPI: 1 ACPI AML tables successfully acquired and loaded -[ 0.452709] ACPI: Interpreter enabled -[ 0.453468] ACPI: PM: (supports S0 S3 S4 S5) -[ 0.453603] ACPI: Using IOAPIC for interrupt routing -[ 0.454022] PCI: Using host bridge windows from ACPI; if necessary, use "pci=nocrs" and report a bug -[ 0.455266] ACPI: Enabled 2 GPEs in block 00 to 0F -[ 0.480013] ACPI: PCI Root Bridge [PCI0] (domain 0000 [bus 00-ff]) -[ 0.480702] acpi PNP0A03:00: _OSC: OS supports [ASPM ClockPM Segments MSI HPX-Type3] -[ 0.481425] acpi PNP0A03:00: fail to add MMCONFIG information, can't access extended PCI configuration space under this bridge. -[ 0.483666] PCI host bridge to bus 0000:00 -[ 0.483848] pci_bus 0000:00: root bus resource [io 0x0000-0x0cf7 window] -[ 0.484096] pci_bus 0000:00: root bus resource [io 0x0d00-0xffff window] -[ 0.484237] pci_bus 0000:00: root bus resource [mem 0x000a0000-0x000bffff window] -[ 0.484480] pci_bus 0000:00: root bus resource [mem 0x08000000-0xfebfffff window] -[ 0.484578] pci_bus 0000:00: root bus resource [mem 0x100000000-0x17fffffff window] -[ 0.484870] pci_bus 0000:00: root bus resource [bus 00-ff] -[ 0.486588] pci 0000:00:00.0: [8086:1237] type 00 class 0x060000 -[ 0.492625] pci 0000:00:01.0: [8086:7000] type 00 class 0x060100 -[ 0.493621] pci 0000:00:01.1: [8086:7010] type 00 class 0x010180 -[ 0.495015] pci 0000:00:01.1: reg 0x20: [io 0xc040-0xc04f] -[ 0.495760] pci 0000:00:01.1: legacy IDE quirk: reg 0x10: [io 0x01f0-0x01f7] -[ 0.495936] pci 0000:00:01.1: legacy IDE quirk: reg 0x14: [io 0x03f6] -[ 0.496095] pci 0000:00:01.1: legacy IDE quirk: reg 0x18: [io 0x0170-0x0177] -[ 0.496598] pci 0000:00:01.1: legacy IDE quirk: reg 0x1c: [io 0x0376] -[ 0.497793] pci 0000:00:01.3: [8086:7113] type 00 class 0x068000 -[ 0.498219] pci 0000:00:01.3: quirk: [io 0x0600-0x063f] claimed by PIIX4 ACPI -[ 0.498384] pci 0000:00:01.3: quirk: [io 0x0700-0x070f] claimed by PIIX4 SMB -[ 0.499487] pci 0000:00:02.0: [1234:1111] type 00 class 0x030000 -[ 0.500186] pci 0000:00:02.0: reg 0x10: [mem 0xfd000000-0xfdffffff pref] -[ 0.500569] pci 0000:00:02.0: reg 0x18: [mem 0xfebf0000-0xfebf0fff] -[ 0.502569] pci 0000:00:02.0: reg 0x30: [mem 0xfebe0000-0xfebeffff pref] -[ 0.508052] pci 0000:00:03.0: [8086:100e] type 00 class 0x020000 -[ 0.508590] pci 0000:00:03.0: reg 0x10: [mem 0xfebc0000-0xfebdffff] -[ 0.509075] pci 0000:00:03.0: reg 0x14: [io 0xc000-0xc03f] -[ 0.511015] pci 0000:00:03.0: reg 0x30: [mem 0xfeb80000-0xfebbffff pref] -[ 0.517286] ACPI: PCI: Interrupt link LNKA configured for IRQ 10 -[ 0.518032] ACPI: PCI: Interrupt link LNKB configured for IRQ 10 -[ 0.518504] ACPI: PCI: Interrupt link LNKC configured for IRQ 11 -[ 0.518920] ACPI: PCI: Interrupt link LNKD configured for IRQ 11 -[ 0.519208] ACPI: PCI: Interrupt link LNKS configured for IRQ 9 -[ 0.521412] iommu: Default domain type: Translated -[ 0.521589] iommu: DMA domain TLB invalidation policy: lazy mode -[ 0.524448] pci 0000:00:02.0: vgaarb: setting as boot VGA device -[ 0.524569] pci 0000:00:02.0: vgaarb: VGA device added: decodes=io+mem,owns=io+mem,locks=none -[ 0.524633] pci 0000:00:02.0: vgaarb: bridge control possible -[ 0.524846] vgaarb: loaded -[ 0.526151] SCSI subsystem initialized -[ 0.528124] ACPI: bus type USB registered -[ 0.528600] usbcore: registered new interface driver usbfs -[ 0.528917] usbcore: registered new interface driver hub -[ 0.529156] usbcore: registered new device driver usb -[ 0.529593] pps_core: LinuxPPS API ver. 1 registered -[ 0.529693] pps_core: Software ver. 5.3.6 - Copyright 2005-2007 Rodolfo Giometti -[ 0.529916] PTP clock support registered -[ 0.531428] Advanced Linux Sound Architecture Driver Initialized. -[ 0.538313] NetLabel: Initializing -[ 0.538413] NetLabel: domain hash size = 128 -[ 0.538513] NetLabel: protocols = UNLABELED CIPSOv4 CALIPSO -[ 0.539300] NetLabel: unlabeled traffic allowed by default -[ 0.540192] PCI: Using ACPI for IRQ routing -[ 0.541336] hpet: 3 channels of 0 reserved for per-cpu timers -[ 0.541742] hpet0: at MMIO 0xfed00000, IRQs 2, 8, 0 -[ 0.541934] hpet0: 3 comparators, 64-bit 100.000000 MHz counter -[ 0.547124] clocksource: Switched to clocksource tsc-early -[ 0.589778] VFS: Disk quotas dquot_6.6.0 -[ 0.590116] VFS: Dquot-cache hash table entries: 512 (order 0, 4096 bytes) -[ 0.591999] pnp: PnP ACPI init -[ 1.348853] pnp: PnP ACPI: found 6 devices -[ 1.363393] clocksource: acpi_pm: mask: 0xffffff max_cycles: 0xffffff, max_idle_ns: 2085701024 ns -[ 1.364026] NET: Registered PF_INET protocol family -[ 1.364871] IP idents hash table entries: 2048 (order: 2, 16384 bytes, linear) -[ 1.369722] tcp_listen_portaddr_hash hash table entries: 256 (order: 0, 4096 bytes, linear) -[ 1.369973] TCP established hash table entries: 1024 (order: 1, 8192 bytes, linear) -[ 1.370241] TCP bind hash table entries: 1024 (order: 2, 16384 bytes, linear) -[ 1.370483] TCP: Hash tables configured (established 1024 bind 1024) -[ 1.371348] UDP hash table entries: 256 (order: 1, 8192 bytes, linear) -[ 1.371835] UDP-Lite hash table entries: 256 (order: 1, 8192 bytes, linear) -[ 1.373053] NET: Registered PF_UNIX/PF_LOCAL protocol family -[ 1.374701] RPC: Registered named UNIX socket transport module. -[ 1.375153] RPC: Registered udp transport module. -[ 1.375280] RPC: Registered tcp transport module. -[ 1.375386] RPC: Registered tcp NFSv4.1 backchannel transport module. -[ 1.377429] pci_bus 0000:00: resource 4 [io 0x0000-0x0cf7 window] -[ 1.377567] pci_bus 0000:00: resource 5 [io 0x0d00-0xffff window] -[ 1.377738] pci_bus 0000:00: resource 6 [mem 0x000a0000-0x000bffff window] -[ 1.377893] pci_bus 0000:00: resource 7 [mem 0x08000000-0xfebfffff window] -[ 1.378032] pci_bus 0000:00: resource 8 [mem 0x100000000-0x17fffffff window] -[ 1.378574] pci 0000:00:01.0: PIIX3: Enabling Passive Release -[ 1.378817] pci 0000:00:00.0: Limiting direct PCI/PCI transfers -[ 1.378993] pci 0000:00:01.0: Activating ISA DMA hang workarounds -[ 1.379296] pci 0000:00:02.0: Video device with shadowed ROM at [mem 0x000c0000-0x000dffff] -[ 1.379537] PCI: CLS 0 bytes, default 64 -[ 1.385473] Unpacking initramfs... -[ 1.394653] Initialise system trusted keyrings -[ 1.395898] workingset: timestamp_bits=56 max_order=15 bucket_order=0 -[ 1.400517] Freeing initrd memory: 1896K -[ 1.409899] NFS: Registering the id_resolver key type -[ 1.410240] Key type id_resolver registered -[ 1.410358] Key type id_legacy registered -[ 1.436299] Key type asymmetric registered -[ 1.436505] Asymmetric key parser 'x509' registered -[ 1.436899] Block layer SCSI generic (bsg) driver version 0.4 loaded (major 251) -[ 1.437334] io scheduler mq-deadline registered -[ 1.437848] io scheduler kyber registered -[ 1.440723] input: Power Button as /devices/LNXSYSTM:00/LNXPWRBN:00/input/input0 -[ 1.443386] ACPI: button: Power Button [PWRF] -[ 1.445654] Serial: 8250/16550 driver, 4 ports, IRQ sharing enabled -[ 1.447264] 00:04: ttyS0 at I/O 0x3f8 (irq = 4, base_baud = 115200) is a 16550A -[ 1.450740] Non-volatile memory driver v1.3 -[ 1.451106] Linux agpgart interface v0.103 -[ 1.467087] loop: module loaded -[ 1.474468] scsi host0: ata_piix -[ 1.476252] scsi host1: ata_piix -[ 1.476701] ata1: PATA max MWDMA2 cmd 0x1f0 ctl 0x3f6 bmdma 0xc040 irq 14 -[ 1.476882] ata2: PATA max MWDMA2 cmd 0x170 ctl 0x376 bmdma 0xc048 irq 15 -[ 1.481539] libphy: Fixed MDIO Bus: probed -[ 1.482188] e100: Intel(R) PRO/100 Network Driver -[ 1.482313] e100: Copyright(c) 1999-2006 Intel Corporation -[ 1.482507] e1000: Intel(R) PRO/1000 Network Driver -[ 1.482702] e1000: Copyright (c) 1999-2006 Intel Corporation. -[ 1.616439] ACPI: \_SB_.LNKC: Enabled at IRQ 11 -[ 1.649465] ata2.00: ATAPI: QEMU DVD-ROM, 2.5+, max UDMA/100 -[ 1.664135] scsi 1:0:0:0: CD-ROM QEMU QEMU DVD-ROM 2.5+ PQ: 0 ANSI: 5 -[ 1.693021] sr 1:0:0:0: [sr0] scsi3-mmc drive: 4x/4x cd/rw xa/form2 tray -[ 1.693338] cdrom: Uniform CD-ROM driver Revision: 3.20 -[ 1.723925] sr 1:0:0:0: Attached scsi generic sg0 type 5 -[ 1.946674] e1000 0000:00:03.0 eth0: (PCI:33MHz:32-bit) 52:54:00:12:34:56 -[ 1.947107] e1000 0000:00:03.0 eth0: Intel(R) PRO/1000 Network Connection -[ 1.947650] e1000e: Intel(R) PRO/1000 Network Driver -[ 1.947749] e1000e: Copyright(c) 1999 - 2015 Intel Corporation. -[ 1.947947] sky2: driver version 1.30 -[ 1.948805] ehci_hcd: USB 2.0 'Enhanced' Host Controller (EHCI) Driver -[ 1.948993] ehci-pci: EHCI PCI platform driver -[ 1.949218] ohci_hcd: USB 1.1 'Open' Host Controller (OHCI) Driver -[ 1.949394] ohci-pci: OHCI PCI platform driver -[ 1.949636] uhci_hcd: USB Universal Host Controller Interface driver -[ 1.950082] usbcore: registered new interface driver usblp -[ 1.950302] usbcore: registered new interface driver usb-storage -[ 1.951012] i8042: PNP: PS/2 Controller [PNP0303:KBD,PNP0f13:MOU] at 0x60,0x64 irq 1,12 -[ 1.954333] serio: i8042 KBD port at 0x60,0x64 irq 1 -[ 1.954634] serio: i8042 AUX port at 0x60,0x64 irq 12 -[ 1.957984] input: AT Translated Set 2 keyboard as /devices/platform/i8042/serio0/input/input1 -[ 1.960071] rtc_cmos 00:05: RTC can wake from S4 -[ 1.964738] rtc_cmos 00:05: registered as rtc0 -[ 1.965357] rtc_cmos 00:05: alarms up to one day, y3k, 242 bytes nvram, hpet irqs -[ 1.966676] device-mapper: ioctl: 4.45.0-ioctl (2021-03-22) initialised: dm-devel@redhat.com -[ 1.967364] hid: raw HID events driver (C) Jiri Kosina -[ 1.968571] usbcore: registered new interface driver usbhid -[ 1.968750] usbhid: USB HID core driver -[ 1.974818] Initializing XFRM netlink socket -[ 1.975673] NET: Registered PF_INET6 protocol family -[ 1.981212] Segment Routing with IPv6 -[ 1.981421] In-situ OAM (IOAM) with IPv6 -[ 1.982292] sit: IPv6, IPv4 and MPLS over IPv4 tunneling driver -[ 1.984278] NET: Registered PF_PACKET protocol family -[ 1.984857] Key type dns_resolver registered -[ 1.985989] IPI shorthand broadcast: enabled -[ 1.986261] sched_clock: Marking stable (1999028700, -13430834)->(1985937339, -339473) -[ 1.987965] registered taskstats version 1 -[ 1.988095] Loading compiled-in X.509 certificates -[ 1.991283] PM: Magic number: 1:335:305 -[ 1.991523] tty tty34: hash matches -[ 1.991951] printk: console [netcon0] enabled -[ 1.992067] netconsole: network logging started -[ 1.994549] cfg80211: Loading compiled-in X.509 certificates for regulatory database -[ 2.004972] kworker/u2:2 (64) used greatest stack depth: 14856 bytes left -[ 2.012521] cfg80211: Loaded X.509 cert 'sforshee: 00b28ddf47aef9cea7' -[ 2.013924] platform regulatory.0: Direct firmware load for regulatory.db failed with error -2 -[ 2.014318] cfg80211: failed to load regulatory.db -[ 2.016106] ALSA device list: -[ 2.016329] No soundcards found. -[ 2.053176] Freeing unused kernel image (initmem) memory: 1368K -[ 2.056095] Write protecting the kernel read-only data: 20480k -[ 2.058248] Freeing unused kernel image (text/rodata gap) memory: 2032K -[ 2.058811] Freeing unused kernel image (rodata/data gap) memory: 500K -[ 2.059164] Run /init as init process -Hello from Golang -[ 2.386879] tsc: Refined TSC clocksource calibration: 3192.032 MHz -[ 2.387114] clocksource: tsc: mask: 0xffffffffffffffff max_cycles: 0x2e02e31fa14, max_idle_ns: 440795264947 ns -[ 2.387380] clocksource: Switched to clocksource tsc -[ 2.587895] input: ImExPS/2 Generic Explorer Mouse as /devices/platform/i8042/serio1/input/input3 -Hello from Golang -Hello from Golang -Hello from Golang diff --git a/assets/pid1/unikernels.png b/assets/pid1/unikernels.png deleted file mode 100644 index 16026ed..0000000 Binary files a/assets/pid1/unikernels.png and /dev/null differ diff --git a/assets/pid1/unikernels.svg b/assets/pid1/unikernels.svg deleted file mode 100644 index 77d1547..0000000 --- a/assets/pid1/unikernels.svg +++ /dev/null @@ -1,578 +0,0 @@ - - - - - - - - - - - - VIRTUAL MACHINE - - - HOST OS / HYPERVISOR - - - VIRTUALMACHINE - GUEST OS - TARGETSOFTWARE - - - HARDWARE - - - - VIRTUALMACHINE - GUEST OS - TARGETSOFTWARE - - CONTAINERS - - - HOST OS - - - - CONTAINER - PROGRAMS &LIBRARIES - TARGETSOFTWARE - - - - HARDWARE - - - - CONTAINER - PROGRAMS &LIBRARIES - TARGETSOFTWARE - - UNIKERNELS - - - HYPERVISOR - - - - UNIKERNEL &APPLICATION - - - - HARDWARE - - - - UNIKERNEL &APPLICATION - - - - - diff --git a/assets/profile-bind-error/error.jpg b/assets/profile-bind-error/error.jpg deleted file mode 100644 index c2e4e8f..0000000 Binary files a/assets/profile-bind-error/error.jpg and /dev/null differ diff --git a/assets/python-profiling/kcachegrind.png b/assets/python-profiling/kcachegrind.png deleted file mode 100644 index 0dc48ab..0000000 Binary files a/assets/python-profiling/kcachegrind.png and /dev/null differ diff --git a/assets/python-profiling/profiling-viewer.png b/assets/python-profiling/profiling-viewer.png deleted file mode 100644 index a450513..0000000 Binary files a/assets/python-profiling/profiling-viewer.png and /dev/null differ diff --git a/assets/python-profiling/snakeviz.png b/assets/python-profiling/snakeviz.png deleted file mode 100644 index 5bab395..0000000 Binary files a/assets/python-profiling/snakeviz.png and /dev/null differ diff --git a/assets/sentiment-analysis/.ipynb_checkpoints/TF Test-checkpoint.ipynb b/assets/sentiment-analysis/.ipynb_checkpoints/TF Test-checkpoint.ipynb deleted file mode 100644 index e2a85c4..0000000 --- a/assets/sentiment-analysis/.ipynb_checkpoints/TF Test-checkpoint.ipynb +++ /dev/null @@ -1,588 +0,0 @@ -{ - "cells": [ - { - "cell_type": "code", - "execution_count": 1, - "metadata": {}, - "outputs": [ - { - "name": "stderr", - "output_type": "stream", - "text": [ - "/home/m/.local/lib/python3.7/site-packages/tensorflow/python/framework/dtypes.py:516: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorflow/python/framework/dtypes.py:517: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorflow/python/framework/dtypes.py:518: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorflow/python/framework/dtypes.py:519: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorflow/python/framework/dtypes.py:520: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorflow/python/framework/dtypes.py:525: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n" - ] - }, - { - "name": "stdout", - "output_type": "stream", - "text": [ - "2.0.0-beta1\n" - ] - }, - { - "name": "stderr", - "output_type": "stream", - "text": [ - "/home/m/.local/lib/python3.7/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:541: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_qint8 = np.dtype([(\"qint8\", np.int8, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:542: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_quint8 = np.dtype([(\"quint8\", np.uint8, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:543: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_qint16 = np.dtype([(\"qint16\", np.int16, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:544: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_quint16 = np.dtype([(\"quint16\", np.uint16, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:545: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " _np_qint32 = np.dtype([(\"qint32\", np.int32, 1)])\n", - "/home/m/.local/lib/python3.7/site-packages/tensorboard/compat/tensorflow_stub/dtypes.py:550: FutureWarning: Passing (type, 1) or '1type' as a synonym of type is deprecated; in a future version of numpy, it will be understood as (type, (1,)) / '(1,)type'.\n", - " np_resource = np.dtype([(\"resource\", np.ubyte, 1)])\n" - ] - } - ], - "source": [ - "import tensorflow as tf\n", - "from tensorflow import keras\n", - "\n", - "# Helper libraries\n", - "import numpy as np\n", - "import matplotlib.pyplot as plt\n", - "\n", - "print(tf.__version__)" - ] - }, - { - "cell_type": "code", - "execution_count": 2, - "metadata": {}, - "outputs": [], - "source": [ - "from numpy import genfromtxt\n", - "data = genfromtxt('data.csv', delimiter=',')" - ] - }, - { - "cell_type": "code", - "execution_count": 3, - "metadata": {}, - "outputs": [], - "source": [ - "data_input = data[:,0:3]\n", - "data_labels = data[:,3]\n", - "\n", - "#data_input = np.transpose(data_input)\n", - "#data_labels = np.transpose(data_labels)" - ] - }, - { - "cell_type": "code", - "execution_count": 4, - "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "(600, 3)\n", - "[1.e-01 1.e+00 3.e+02]\n" - ] - } - ], - "source": [ - "print(np.shape(data_input))\n", - "print(data_input[2])" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "print(len(data_input))\n", - "print(len(data_labels))" - ] - }, - { - "cell_type": "code", - "execution_count": 5, - "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "(500, 3)\n", - "(100, 3)\n", - "(500,)\n", - "(100,)\n" - ] - } - ], - "source": [ - "data_input_train = data_input[0:500,:]\n", - "data_input_test = data_input[500:,:]\n", - "\n", - "data_labels_train = data_labels[0:500]\n", - "data_labels_test = data_labels[500:]\n", - "\n", - "print(np.shape(data_input_train))\n", - "print(np.shape(data_input_test))\n", - "\n", - "print(np.shape(data_labels_train))\n", - "print(np.shape(data_labels_test))" - ] - }, - { - "cell_type": "code", - "execution_count": 6, - "metadata": {}, - "outputs": [], - "source": [ - "model = keras.Sequential([\n", - " keras.layers.Dense(128, activation='relu', input_shape=[3]),\n", - " keras.layers.Dense(512, activation='relu'),\n", - " keras.layers.Dense(512, activation='relu'),\n", - " keras.layers.Dense(512, activation='relu'),\n", - " keras.layers.Dense(128, activation='relu'),\n", - " keras.layers.Dense(1)\n", - "])" - ] - }, - { - "cell_type": "code", - "execution_count": 7, - "metadata": {}, - "outputs": [], - "source": [ - "optimizer = tf.keras.optimizers.RMSprop(0.001)\n", - "model.compile(loss='mse',\n", - " optimizer=optimizer,\n", - " metrics=['accuracy'])" - ] - }, - { - "cell_type": "code", - "execution_count": 8, - "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "Train on 500 samples\n", - "Epoch 1/100\n", - "500/500 [==============================] - 0s 399us/sample - loss: 247.2794 - accuracy: 0.0040\n", - "Epoch 2/100\n", - "500/500 [==============================] - 0s 121us/sample - loss: 4.2495 - accuracy: 0.0060\n", - "Epoch 3/100\n", - "500/500 [==============================] - 0s 131us/sample - loss: 1.8787 - accuracy: 0.0040\n", - "Epoch 4/100\n", - "500/500 [==============================] - 0s 121us/sample - loss: 0.4284 - accuracy: 0.0060\n", - "Epoch 5/100\n", - "500/500 [==============================] - 0s 107us/sample - loss: 4.7904 - accuracy: 0.0080\n", - "Epoch 6/100\n", - "500/500 [==============================] - 0s 113us/sample - loss: 0.0819 - accuracy: 0.0040\n", - "Epoch 7/100\n", - "500/500 [==============================] - 0s 108us/sample - loss: 1.6904 - accuracy: 0.0040\n", - "Epoch 8/100\n", - "500/500 [==============================] - 0s 116us/sample - loss: 0.1761 - accuracy: 0.0040\n", - "Epoch 9/100\n", - "500/500 [==============================] - 0s 142us/sample - loss: 0.1135 - accuracy: 0.0040\n", - "Epoch 10/100\n", - "500/500 [==============================] - 0s 124us/sample - loss: 0.4387 - accuracy: 0.0040\n", - "Epoch 11/100\n", - "500/500 [==============================] - 0s 112us/sample - loss: 0.0815 - accuracy: 0.0040\n", - "Epoch 12/100\n", - "500/500 [==============================] - 0s 117us/sample - loss: 0.1725 - accuracy: 0.0040\n", - "Epoch 13/100\n", - "500/500 [==============================] - 0s 119us/sample - loss: 0.1487 - accuracy: 0.0040\n", - "Epoch 14/100\n", - "500/500 [==============================] - 0s 111us/sample - loss: 0.0720 - accuracy: 0.0040\n", - "Epoch 15/100\n", - "500/500 [==============================] - 0s 111us/sample - loss: 0.3110 - accuracy: 0.0040\n", - "Epoch 16/100\n", - "500/500 [==============================] - 0s 128us/sample - loss: 0.0947 - accuracy: 0.0040\n", - "Epoch 17/100\n", - "500/500 [==============================] - 0s 133us/sample - loss: 0.0739 - accuracy: 0.0040\n", - "Epoch 18/100\n", - "500/500 [==============================] - 0s 131us/sample - loss: 0.1353 - accuracy: 0.0060\n", - "Epoch 19/100\n", - "500/500 [==============================] - 0s 135us/sample - loss: 0.0837 - accuracy: 0.0040\n", - "Epoch 20/100\n", - "500/500 [==============================] - 0s 130us/sample - loss: 0.0754 - accuracy: 0.0040\n", - "Epoch 21/100\n", - "500/500 [==============================] - 0s 118us/sample - loss: 0.0840 - accuracy: 0.0040\n", - "Epoch 22/100\n", - "500/500 [==============================] - 0s 115us/sample - loss: 0.1105 - accuracy: 0.0040\n", - "Epoch 23/100\n", - "500/500 [==============================] - 0s 116us/sample - loss: 0.0651 - accuracy: 0.0040\n", - "Epoch 24/100\n", - "500/500 [==============================] - 0s 109us/sample - loss: 0.0615 - accuracy: 0.0040\n", - "Epoch 25/100\n", - "500/500 [==============================] - 0s 118us/sample - loss: 0.0656 - accuracy: 0.0040\n", - "Epoch 26/100\n", - "500/500 [==============================] - 0s 113us/sample - loss: 0.0695 - accuracy: 0.0040\n", - "Epoch 27/100\n", - "500/500 [==============================] - 0s 116us/sample - loss: 0.0585 - accuracy: 0.0040\n", - "Epoch 28/100\n", - "500/500 [==============================] - 0s 118us/sample - loss: 0.1300 - accuracy: 0.0040\n", - "Epoch 29/100\n", - "500/500 [==============================] - 0s 112us/sample - loss: 0.0567 - accuracy: 0.0040\n", - "Epoch 30/100\n", - "500/500 [==============================] - 0s 137us/sample - loss: 0.0647 - accuracy: 0.0040\n", - "Epoch 31/100\n", - "500/500 [==============================] - 0s 130us/sample - loss: 0.0559 - accuracy: 0.0040\n", - "Epoch 32/100\n", - "500/500 [==============================] - 0s 130us/sample - loss: 0.0576 - accuracy: 0.0040\n", - "Epoch 33/100\n", - "500/500 [==============================] - 0s 128us/sample - loss: 0.0578 - accuracy: 0.0040\n", - "Epoch 34/100\n", - "500/500 [==============================] - 0s 130us/sample - loss: 0.0512 - accuracy: 0.0040\n", - "Epoch 35/100\n", - "500/500 [==============================] - 0s 114us/sample - loss: 0.0601 - accuracy: 0.0040\n", - "Epoch 36/100\n", - "500/500 [==============================] - 0s 111us/sample - loss: 0.0531 - accuracy: 0.0040\n", - "Epoch 37/100\n", - "500/500 [==============================] - 0s 130us/sample - loss: 0.0532 - accuracy: 0.0040\n", - "Epoch 38/100\n", - "500/500 [==============================] - 0s 131us/sample - loss: 0.0480 - accuracy: 0.0040\n", - "Epoch 39/100\n", - "500/500 [==============================] - 0s 136us/sample - loss: 0.0503 - accuracy: 0.0040\n", - "Epoch 40/100\n", - "500/500 [==============================] - 0s 134us/sample - loss: 0.0468 - accuracy: 0.0040\n", - "Epoch 41/100\n", - "500/500 [==============================] - 0s 115us/sample - loss: 0.0509 - accuracy: 0.0040\n", - "Epoch 42/100\n", - "500/500 [==============================] - 0s 109us/sample - loss: 0.0453 - accuracy: 0.0040\n", - "Epoch 43/100\n", - "500/500 [==============================] - 0s 111us/sample - loss: 0.0484 - accuracy: 0.0040\n", - "Epoch 44/100\n", - "500/500 [==============================] - 0s 104us/sample - loss: 0.0458 - accuracy: 0.0040\n", - "Epoch 45/100\n", - "500/500 [==============================] - 0s 110us/sample - loss: 0.0481 - accuracy: 0.0040\n", - "Epoch 46/100\n", - "500/500 [==============================] - 0s 114us/sample - loss: 0.0468 - accuracy: 0.0060\n", - "Epoch 47/100\n", - "500/500 [==============================] - 0s 124us/sample - loss: 0.0473 - accuracy: 0.0060\n", - "Epoch 48/100\n", - "500/500 [==============================] - 0s 137us/sample - loss: 0.0455 - accuracy: 0.0040\n", - "Epoch 49/100\n", - "500/500 [==============================] - 0s 125us/sample - loss: 0.0431 - accuracy: 0.0060\n", - "Epoch 50/100\n", - "500/500 [==============================] - 0s 132us/sample - loss: 0.0432 - accuracy: 0.0060\n", - "Epoch 51/100\n", - "500/500 [==============================] - 0s 116us/sample - loss: 0.0484 - accuracy: 0.0060\n", - "Epoch 52/100\n", - "500/500 [==============================] - 0s 112us/sample - loss: 0.0482 - accuracy: 0.0040\n", - "Epoch 53/100\n", - "500/500 [==============================] - 0s 117us/sample - loss: 0.0444 - accuracy: 0.0060\n", - "Epoch 54/100\n", - "500/500 [==============================] - 0s 109us/sample - loss: 0.0469 - accuracy: 0.0060\n", - "Epoch 55/100\n", - "500/500 [==============================] - 0s 106us/sample - loss: 0.0427 - accuracy: 0.0040\n", - "Epoch 56/100\n", - "500/500 [==============================] - 0s 110us/sample - loss: 0.0433 - accuracy: 0.0040\n", - "Epoch 57/100\n", - "500/500 [==============================] - 0s 102us/sample - loss: 0.0437 - accuracy: 0.0060\n", - "Epoch 58/100\n", - "500/500 [==============================] - 0s 117us/sample - loss: 0.0425 - accuracy: 0.0040\n", - "Epoch 59/100\n", - "500/500 [==============================] - 0s 105us/sample - loss: 0.0418 - accuracy: 0.0040\n", - "Epoch 60/100\n", - "500/500 [==============================] - 0s 109us/sample - loss: 0.0397 - accuracy: 0.0040\n", - "Epoch 61/100\n", - "500/500 [==============================] - 0s 119us/sample - loss: 0.0507 - accuracy: 0.0040\n", - "Epoch 62/100\n", - "500/500 [==============================] - 0s 112us/sample - loss: 0.0402 - accuracy: 0.0060\n", - "Epoch 63/100\n", - "500/500 [==============================] - 0s 133us/sample - loss: 0.0397 - accuracy: 0.0040\n", - "Epoch 64/100\n", - "500/500 [==============================] - 0s 132us/sample - loss: 0.0427 - accuracy: 0.0060\n", - "Epoch 65/100\n", - "500/500 [==============================] - 0s 138us/sample - loss: 0.0398 - accuracy: 0.0040\n", - "Epoch 66/100\n", - "500/500 [==============================] - 0s 145us/sample - loss: 0.0375 - accuracy: 0.0060\n", - "Epoch 67/100\n", - "500/500 [==============================] - 0s 138us/sample - loss: 0.0402 - accuracy: 0.0060\n", - "Epoch 68/100\n", - "500/500 [==============================] - 0s 132us/sample - loss: 0.0388 - accuracy: 0.0080\n", - "Epoch 69/100\n", - "500/500 [==============================] - 0s 115us/sample - loss: 0.0375 - accuracy: 0.0080\n", - "Epoch 70/100\n", - "500/500 [==============================] - 0s 113us/sample - loss: 0.0384 - accuracy: 0.0040\n", - "Epoch 71/100\n", - "500/500 [==============================] - 0s 109us/sample - loss: 0.0360 - accuracy: 0.0080\n", - "Epoch 72/100\n", - "500/500 [==============================] - 0s 111us/sample - loss: 0.0350 - accuracy: 0.0080\n", - "Epoch 73/100\n", - "500/500 [==============================] - 0s 118us/sample - loss: 0.0370 - accuracy: 0.0060\n", - "Epoch 74/100\n", - "500/500 [==============================] - 0s 95us/sample - loss: 0.0354 - accuracy: 0.0080\n", - "Epoch 75/100\n", - "500/500 [==============================] - 0s 102us/sample - loss: 0.0376 - accuracy: 0.0060\n", - "Epoch 76/100\n", - "500/500 [==============================] - 0s 106us/sample - loss: 0.0371 - accuracy: 0.0080\n", - "Epoch 77/100\n", - "500/500 [==============================] - 0s 100us/sample - loss: 0.0369 - accuracy: 0.0060\n", - "Epoch 78/100\n" - ] - }, - { - "name": "stdout", - "output_type": "stream", - "text": [ - "500/500 [==============================] - 0s 98us/sample - loss: 0.0315 - accuracy: 0.0060\n", - "Epoch 79/100\n", - "500/500 [==============================] - 0s 97us/sample - loss: 0.0355 - accuracy: 0.0060\n", - "Epoch 80/100\n", - "500/500 [==============================] - 0s 100us/sample - loss: 0.0278 - accuracy: 0.0080\n", - "Epoch 81/100\n", - "500/500 [==============================] - 0s 99us/sample - loss: 0.0320 - accuracy: 0.0080\n", - "Epoch 82/100\n", - "500/500 [==============================] - 0s 99us/sample - loss: 0.0321 - accuracy: 0.0080\n", - "Epoch 83/100\n", - "500/500 [==============================] - 0s 94us/sample - loss: 0.0332 - accuracy: 0.0060\n", - "Epoch 84/100\n", - "500/500 [==============================] - 0s 106us/sample - loss: 0.0317 - accuracy: 0.0060\n", - "Epoch 85/100\n", - "500/500 [==============================] - 0s 103us/sample - loss: 0.0293 - accuracy: 0.0080\n", - "Epoch 86/100\n", - "500/500 [==============================] - 0s 107us/sample - loss: 0.0304 - accuracy: 0.0060\n", - "Epoch 87/100\n", - "500/500 [==============================] - 0s 101us/sample - loss: 0.0327 - accuracy: 0.0040\n", - "Epoch 88/100\n", - "500/500 [==============================] - 0s 100us/sample - loss: 0.0290 - accuracy: 0.0080\n", - "Epoch 89/100\n", - "500/500 [==============================] - 0s 123us/sample - loss: 0.0293 - accuracy: 0.0060\n", - "Epoch 90/100\n", - "500/500 [==============================] - 0s 104us/sample - loss: 0.0246 - accuracy: 0.0060\n", - "Epoch 91/100\n", - "500/500 [==============================] - 0s 124us/sample - loss: 0.0303 - accuracy: 0.0060\n", - "Epoch 92/100\n", - "500/500 [==============================] - 0s 129us/sample - loss: 0.0376 - accuracy: 0.0080\n", - "Epoch 93/100\n", - "500/500 [==============================] - 0s 122us/sample - loss: 0.0264 - accuracy: 0.0080\n", - "Epoch 94/100\n", - "500/500 [==============================] - 0s 102us/sample - loss: 0.0265 - accuracy: 0.0080\n", - "Epoch 95/100\n", - "500/500 [==============================] - 0s 108us/sample - loss: 0.0291 - accuracy: 0.0080\n", - "Epoch 96/100\n", - "500/500 [==============================] - 0s 101us/sample - loss: 0.0314 - accuracy: 0.0080\n", - "Epoch 97/100\n", - "500/500 [==============================] - 0s 95us/sample - loss: 0.0257 - accuracy: 0.0060\n", - "Epoch 98/100\n", - "500/500 [==============================] - 0s 100us/sample - loss: 0.0248 - accuracy: 0.0080\n", - "Epoch 99/100\n", - "500/500 [==============================] - 0s 94us/sample - loss: 0.0250 - accuracy: 0.0040\n", - "Epoch 100/100\n", - "500/500 [==============================] - 0s 106us/sample - loss: 0.0312 - accuracy: 0.0060\n" - ] - }, - { - "data": { - "text/plain": [ - "" - ] - }, - "execution_count": 8, - "metadata": {}, - "output_type": "execute_result" - } - ], - "source": [ - "#model.fit(data_input_train, data_labels_train, validation_data=(data_input_test, data_labels_test), epochs=100)\n", - "model.fit(data_input_train, data_labels_train, epochs=100)" - ] - }, - { - "cell_type": "code", - "execution_count": 9, - "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "100/100 - 0s - loss: 0.0470 - accuracy: 0.0100\n", - "\n", - "Test accuracy: 0.01\n" - ] - } - ], - "source": [ - "test_loss, test_acc = model.evaluate(data_input_test, data_labels_test, verbose=2)\n", - "\n", - "print('\\nTest accuracy:', test_acc)" - ] - }, - { - "cell_type": "code", - "execution_count": 10, - "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "[[0.3141548]]\n" - ] - } - ], - "source": [ - "input = np.array([0.46,2,136])\n", - "input.shape = (1,3)\n", - "\n", - "prediction = model.predict(input)\n", - "print(prediction)" - ] - }, - { - "cell_type": "code", - "execution_count": 11, - "metadata": {}, - "outputs": [], - "source": [ - "predictions = model.predict(data_input_test)" - ] - }, - { - "cell_type": "code", - "execution_count": 12, - "metadata": {}, - "outputs": [], - "source": [ - "%matplotlib qt \n", - "plt.plot(predictions)\n", - "plt.plot(data_labels_test, 'r')\n", - "plt.show()" - ] - }, - { - "cell_type": "code", - "execution_count": 204, - "metadata": {}, - "outputs": [], - "source": [ - "%matplotlib qt\n", - "a = data_labels_test - predictions\n", - "plt.plot(a[0])\n", - "plt.show()" - ] - }, - { - "cell_type": "code", - "execution_count": 207, - "metadata": {}, - "outputs": [], - "source": [ - "%matplotlib qt\n", - "a = data_labels_test - predictions\n", - "plt.plot(predictions)\n", - "plt.plot(data_labels_test, 'r')\n", - "plt.plot(a[0], 'g')\n", - "plt.show()" - ] - }, - { - "cell_type": "code", - "execution_count": 180, - "metadata": {}, - "outputs": [ - { - "data": { - "text/plain": [ - "-0.08489150602276586" - ] - }, - "execution_count": 180, - "metadata": {}, - "output_type": "execute_result" - } - ], - "source": [ - "np.average(a[0])" - ] - }, - { - "cell_type": "code", - "execution_count": 182, - "metadata": {}, - "outputs": [ - { - "name": "stdout", - "output_type": "stream", - "text": [ - "Model: \"sequential_13\"\n", - "_________________________________________________________________\n", - "Layer (type) Output Shape Param # \n", - "=================================================================\n", - "dense_38 (Dense) (None, 128) 512 \n", - "_________________________________________________________________\n", - "dense_39 (Dense) (None, 512) 66048 \n", - "_________________________________________________________________\n", - "dense_40 (Dense) (None, 512) 262656 \n", - "_________________________________________________________________\n", - "dense_41 (Dense) (None, 512) 262656 \n", - "_________________________________________________________________\n", - "dense_42 (Dense) (None, 128) 65664 \n", - "_________________________________________________________________\n", - "dense_43 (Dense) (None, 1) 129 \n", - "=================================================================\n", - "Total params: 657,665\n", - "Trainable params: 657,665\n", - "Non-trainable params: 0\n", - "_________________________________________________________________\n" - ] - } - ], - "source": [ - "model.summary()" - ] - }, - { - "cell_type": "code", - "execution_count": 183, - "metadata": {}, - "outputs": [], - "source": [ - "model.save('my_model.h5')" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [] - } - ], - "metadata": { - "kernelspec": { - "display_name": "Python 3", - "language": "python", - "name": "python3" - }, - "language_info": { - "codemirror_mode": { - "name": "ipython", - "version": 3 - }, - "file_extension": ".py", - "mimetype": "text/x-python", - "name": "python", - "nbconvert_exporter": "python", - "pygments_lexer": "ipython3", - "version": "3.7.3" - } - }, - "nbformat": 4, - "nbformat_minor": 2 -} diff --git a/assets/sentiment-analysis/.ipynb_checkpoints/sentiment-analysis-checkpoint.ipynb b/assets/sentiment-analysis/.ipynb_checkpoints/sentiment-analysis-checkpoint.ipynb deleted file mode 100644 index 2c0934c..0000000 --- a/assets/sentiment-analysis/.ipynb_checkpoints/sentiment-analysis-checkpoint.ipynb +++ /dev/null @@ -1,170 +0,0 @@ -{ - "cells": [ - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "# Sentiment analysis of Guardian World News articles" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "## Get articles from a website" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Install rss parser dependency" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "!pip3 install feedparser" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Parsing RSS feed for world news" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "import feedparser\n", - "feed_url = \"https://www.theguardian.com/world/rss\"\n", - "feed = feedparser.parse(feed_url)" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "import re\n", - "for item in feed.entries:\n", - " # sanitize html\n", - " item.description = re.sub('<[^<]+?>', '', item.description)" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Install Vader Sentiment library and perform sentiment analysis" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "!pip3 install vaderSentiment" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "from vaderSentiment.vaderSentiment import SentimentIntensityAnalyzer\n", - "analyser = SentimentIntensityAnalyzer()" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "sentiment_results = []\n", - "for item in feed.entries:\n", - " sentiment_title = analyser.polarity_scores(item.title)\n", - " sentiment_description = analyser.polarity_scores(item.description)\n", - " sentiment_results.append([sentiment_title['compound'], sentiment_description['compound']])" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Install Matplotlib and visualize compound score" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "!pip3 install matplotlib" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "import matplotlib.pyplot as plt" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "%matplotlib inline\n", - "plt.rcParams['figure.figsize'] = (15, 3)\n", - "plt.plot(sentiment_results, drawstyle='steps')\n", - "plt.title('Sentiment analysis relationship between title and description (Guardian World News)')\n", - "plt.legend(['title', 'description'])\n", - "plt.show()" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [] - } - ], - "metadata": { - "kernelspec": { - "display_name": "Python 3", - "language": "python", - "name": "python3" - }, - "language_info": { - "codemirror_mode": { - "name": "ipython", - "version": 3 - }, - "file_extension": ".py", - "mimetype": "text/x-python", - "name": "python", - "nbconvert_exporter": "python", - "pygments_lexer": "ipython3", - "version": "3.7.3" - } - }, - "nbformat": 4, - "nbformat_minor": 4 -} diff --git a/assets/sentiment-analysis/guardian-sa-title-desc-relationship.png b/assets/sentiment-analysis/guardian-sa-title-desc-relationship.png deleted file mode 100644 index 7195bbf..0000000 Binary files a/assets/sentiment-analysis/guardian-sa-title-desc-relationship.png and /dev/null differ diff --git a/assets/sentiment-analysis/sentiment-analysis.ipynb b/assets/sentiment-analysis/sentiment-analysis.ipynb deleted file mode 100644 index 2c0934c..0000000 --- a/assets/sentiment-analysis/sentiment-analysis.ipynb +++ /dev/null @@ -1,170 +0,0 @@ -{ - "cells": [ - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "# Sentiment analysis of Guardian World News articles" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "## Get articles from a website" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Install rss parser dependency" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "!pip3 install feedparser" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Parsing RSS feed for world news" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "import feedparser\n", - "feed_url = \"https://www.theguardian.com/world/rss\"\n", - "feed = feedparser.parse(feed_url)" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "import re\n", - "for item in feed.entries:\n", - " # sanitize html\n", - " item.description = re.sub('<[^<]+?>', '', item.description)" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Install Vader Sentiment library and perform sentiment analysis" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "!pip3 install vaderSentiment" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "from vaderSentiment.vaderSentiment import SentimentIntensityAnalyzer\n", - "analyser = SentimentIntensityAnalyzer()" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "sentiment_results = []\n", - "for item in feed.entries:\n", - " sentiment_title = analyser.polarity_scores(item.title)\n", - " sentiment_description = analyser.polarity_scores(item.description)\n", - " sentiment_results.append([sentiment_title['compound'], sentiment_description['compound']])" - ] - }, - { - "cell_type": "markdown", - "metadata": {}, - "source": [ - "### Install Matplotlib and visualize compound score" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "!pip3 install matplotlib" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "import matplotlib.pyplot as plt" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [ - "%matplotlib inline\n", - "plt.rcParams['figure.figsize'] = (15, 3)\n", - "plt.plot(sentiment_results, drawstyle='steps')\n", - "plt.title('Sentiment analysis relationship between title and description (Guardian World News)')\n", - "plt.legend(['title', 'description'])\n", - "plt.show()" - ] - }, - { - "cell_type": "code", - "execution_count": null, - "metadata": {}, - "outputs": [], - "source": [] - } - ], - "metadata": { - "kernelspec": { - "display_name": "Python 3", - "language": "python", - "name": "python3" - }, - "language_info": { - "codemirror_mode": { - "name": "ipython", - "version": 3 - }, - "file_extension": ".py", - "mimetype": "text/x-python", - "name": "python", - "nbconvert_exporter": "python", - "pygments_lexer": "ipython3", - "version": "3.7.3" - } - }, - "nbformat": 4, - "nbformat_minor": 4 -} diff --git a/assets/simple-pubsub-server/caniuse.png b/assets/simple-pubsub-server/caniuse.png deleted file mode 100644 index 90f7883..0000000 Binary files a/assets/simple-pubsub-server/caniuse.png and /dev/null differ diff --git a/assets/simple-pubsub-server/chrome-debugging.png b/assets/simple-pubsub-server/chrome-debugging.png deleted file mode 100644 index 1bdc448..0000000 Binary files a/assets/simple-pubsub-server/chrome-debugging.png and /dev/null differ diff --git a/assets/simple-pubsub-server/clients.mp4 b/assets/simple-pubsub-server/clients.mp4 deleted file mode 100644 index 62a3bcf..0000000 Binary files a/assets/simple-pubsub-server/clients.mp4 and /dev/null differ diff --git a/assets/simple-pubsub-server/pubsub-overview.png b/assets/simple-pubsub-server/pubsub-overview.png deleted file mode 100644 index 0279ec3..0000000 Binary files a/assets/simple-pubsub-server/pubsub-overview.png and /dev/null differ diff --git a/assets/simple-pubsub-server/sse-pubsub-server.zip b/assets/simple-pubsub-server/sse-pubsub-server.zip deleted file mode 100644 index 898b290..0000000 Binary files a/assets/simple-pubsub-server/sse-pubsub-server.zip and /dev/null differ diff --git a/assets/wap/emulator.mp4 b/assets/wap/emulator.mp4 deleted file mode 100644 index e4f59aa..0000000 Binary files a/assets/wap/emulator.mp4 and /dev/null differ diff --git a/assets/wap/phones.gif b/assets/wap/phones.gif deleted file mode 100644 index 15f99e2..0000000 Binary files a/assets/wap/phones.gif and /dev/null differ diff --git a/assets/world-clock/enclosure.stl b/assets/world-clock/enclosure.stl deleted file mode 100644 index 99f3d1a..0000000 Binary files a/assets/world-clock/enclosure.stl and /dev/null differ diff --git a/assets/world-clock/hardware.jpg b/assets/world-clock/hardware.jpg deleted file mode 100644 index 315a04d..0000000 Binary files a/assets/world-clock/hardware.jpg and /dev/null differ diff --git a/assets/world-clock/world-clock.jpg b/assets/world-clock/world-clock.jpg deleted file mode 100644 index afdb6e2..0000000 Binary files a/assets/world-clock/world-clock.jpg and /dev/null differ diff --git a/assets/yapyap/hello.png b/assets/yapyap/hello.png deleted file mode 100644 index d141cd3..0000000 Binary files a/assets/yapyap/hello.png and /dev/null differ diff --git a/assets/yapyap/pid1.jpg b/assets/yapyap/pid1.jpg deleted file mode 100644 index 99bc1d8..0000000 Binary files a/assets/yapyap/pid1.jpg and /dev/null differ -- cgit v1.2.3