From 58904b7d9b781c9a7eb18183392b3a565fdbcd51 Mon Sep 17 00:00:00 2001 From: Mitja Felicijan Date: Sat, 8 Jul 2023 23:26:39 +0200 Subject: Removed public folder --- public/what-would-dna-sound-if-synthesized.html | 204 ------------------------ 1 file changed, 204 deletions(-) delete mode 100755 public/what-would-dna-sound-if-synthesized.html (limited to 'public/what-would-dna-sound-if-synthesized.html') diff --git a/public/what-would-dna-sound-if-synthesized.html b/public/what-would-dna-sound-if-synthesized.html deleted file mode 100755 index 17209a7..0000000 --- a/public/what-would-dna-sound-if-synthesized.html +++ /dev/null @@ -1,204 +0,0 @@ -What would DNA sound if synthesized to an audio file

What would DNA sound if synthesized to an audio file

Jul 5, 2022

Introduction

Lately, I have been thinking a lot about the nature of life, what are the -foundation blocks of life and things like that. It's remarkable how complex and -on the other hand simple the creation is when you look at it. The miracle of -life keeps us grounded when our imagination goes wild. If the DNA are the blocks -of life, you could consider them to be an API nature provided us to better -understand all of this chaos masquerading as order.

I have been reading a lot about superintelligence and our somehow misguided path -to create general artificial intelligence. What would the building blocks or our -creation look like? Is the compression really the ultimate storage of -information? Will our creation also ponder this questions when creating new -worlds for themselves, or will we just disappear into the vastness of -possibilities? It is a little offensive that we are playing God whilst being -completely ignorant of our own reality. Who knows! Like many other -breakthroughs, this one will also come at a cost not known to us when it finally -happens.

To keep things a bit lighter, I decided to convert some popular DNA sequences -into an audio files for us to listen to. I am not the first one, nor I will be -the last one to do this. But it is an interesting exercise in better -understanding the relationship between art and science. Maybe listening to DNA -instead of parsing it will find a way into better understanding, or at least -enjoying the creation and cryptic nature of life.

DNA encoding and primer example

I have been exploring DNA in the past in my post from about 3 years ago in -Encoding binary data into DNA -sequence where I have been -converting all sorts of data into DNA sequences.

This will be a similar exercise but instead of converting to DNA, I will be -generating tones from Nucleotides.
NucleotidesNoteFrequency
A (Adenine)A440 Hz
C (Cytosine)C783.99 Hz
G (Guanine)G523.25 Hz
T (Thymine)D587.33 Hz

Since we do not have T in equal-tempered scale, I choose D to represent T note.

You can check Frequencies for equal-tempered scale, A4 = 440 -Hz. For this tuning, we also -choose Speed of Sound = 345 m/s = 1130 ft/s = 770 miles/hr.

Now that we have this out of the way, we can also brush up on the DNA sequencing -a bit. This is a famous quote I also used for the encoding tests, and it goes -like this.

How wonderful that we have met with a paradox. Now we have some hope of -making progress. -― Niels Bohr

>SEQ1
-GACAGCTTGTGTACAAGTGTGCTTGCTCGCGAGCGGGTACGCGCGTGGGCTAACAAGTGA
-GCCAGCAGGTGAACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGCTGGCGGGTGA
-ACAAGTGTGCCGGTGAGCCAACAAGCAGACAAGTAAGCAGGTACGCAGGCGAGCTTGTCA
-ACTCACAAGATCGCTTGTGTACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGTAT
-GCTTGCTGGCGGACAAGCCAGCTTGTAAGCGGACAAGCTTGCGCACAAGCTGGCAGGCCT
-GCCGGCTCGCGTACAAATTCACAAGTAAGTACGCTTGCGTGTACGCGGGTATGTATACTC
-AACCTCACCAAACGGGACAAGATCGCCGGCGGGCTAGTATACAAGAACGCTTGCCAGTAC
-AACC
-

This is what we gonna work with to get things rolling forward, when creating -parser and waveform generator.

Parsing DNA data

This step is rather simple one. All we need to do is parse input DNA sequence in -FASTA format well known in -Bioinformatics to extract single -Nucleotides that will be converted into separate tones based on equal-tempered -scale explained above.

nucleotide_tone_map = {
-  'A': 440,
-  'C': 523.25,
-  'G': 783.99,
-  'T': 587.33,  # converted to D
-}
-
-def split(word):
-  return [char for char in word]
-
-def generate_from_dna_sequence(sequence):
-  for nucleotide in split(sequence):
-    print(nucleotide, nucleotide_tone_map[nucleotide])
-

Generating sine wave

Because we are essentially creating a long stream of notes we will be appending -sine notes to a global array we will later use for creating a WAV file out of -it.

import math
-
-def append_sinewave(freq=440.0, duration_milliseconds=500, volume=1.0):
-  global audio
-
-  num_samples = duration_milliseconds * (sample_rate / 1000.0)
-
-  for x in range(int(num_samples)):
-    audio.append(volume * math.sin(2 * math.pi * freq * (x / sample_rate)))
-
-  return
-

The sine wave generated here is the standard beep. If you want something more -aggressive, you could try a square or saw tooth waveform.

Generating a WAV file from accumulated sine waves

import wave
-import struct
-
-def save_wav(file_name):
-  wav_file = wave.open(file_name, 'w')
-  nchannels = 1
-  sampwidth = 2
-
-  nframes = len(audio)
-  comptype = 'NONE'
-  compname = 'not compressed'
-  wav_file.setparams((nchannels, sampwidth, sample_rate, nframes, comptype, compname))
-
-  for sample in audio:
-    wav_file.writeframes(struct.pack('h', int(sample * 32767.0)))
-
-  wav_file.close()
-

44100 is the industry standard sample rate - CD quality. If you need to save on -file size, you can adjust it downwards. The standard for low quality is, 8000 or -8kHz.

WAV files here are using short, 16 bit, signed integers for the sample size. -So, we multiply the floating-point data we have by 32767, the maximum value for -a short integer.

It is theoretically possible to use the floating point -1.0 to 1.0 data -directly in a WAV file, but not obvious how to do that using the wave module -in Python.

Generating Spectograms

I have tried two methods of doing this and both were just fine. I however opted -out to use the SoX - Sound eXchange, the Swiss Army knife of audio -manipulation one because it didn't require -anything else.

sox output.wav -n spectrogram -o spectrogram.png
-

An example spectrogram of Ludwig van Beethoven Symphony No. 6 First movement.

Ludwig van Beethoven Symphony No. 6 First movement

The other option could also be in combination with -gnuplot. This would require an intermediary step, -however.

sox output.wav audio.dat
-tail -n+3 audio.dat > audio_only.dat
-gnuplot audio.gpi
-

And input file audio.gpi that would be passed to gnuplot looks something like -this.

# set output format and size
-set term png size 1000,280
-
-# set output file
-set output "audio.png"
-
-# set y range
-set yr [-1:1]
-
-# we want just the data
-unset key
-unset tics
-unset border
-set lmargin 0
-set rmargin 0
-set tmargin 0
-set bmargin 0
-
-# draw rectangle to change background color
-set obj 1 rectangle behind from screen 0,0 to screen 1,1
-set obj 1 fillstyle solid 1.0 fillcolor rgbcolor "#ffffff"
-
-# draw data with foreground color
-plot "audio_only.dat" with lines lt rgb 'red'
-

Pre-generated sequences

What I did was take interesting parts from an animal's genome and feed it to a -tone generator script. This then generated a WAV file and I converted those to -MP3, so they can be played in a browser. The last step was creating a -spectrogram based on a WAV file.

Niels Bohr quote

Spectogram

Mouse

This is part of a mouse genome Mus_musculus.GRCm39.dna.nonchromosomal. You -can get genom data -here.

Spectogram

Bison

This is part of a bison genome Bison_bison_bison.Bison_UMD1.0.cdna. You can -get genom data -here.

Spectogram

Taurus

This is part of a taurus genome Bos_taurus.ARS-UCD1.2.cdna. You can get -genom data -here.

Spectogram

Making a drummer out of a DNA sequence

To make things even more interesting, I decided to send this data via MIDI to my -Elektron Model:Samples. This is a -really cool piece of equipment that supports MIDI in via USB and 3.5 mm audio -jack.

Elektron is connected to my MacBook via USB cable and audio out is patched to a -Sony Bluetooth speaker I have that supports 3.5 mm audio in. Elektron doesn't -have internal speakers.

For communicating with Elektron, I choose pygame Python module that has MIDI -built in. With this, it was rather simple to send notes to the device. All I did -was map MIDI notes to the actual Nucleotides.

Before all of this I also checked Audio MIDI Setup app under MacOS and checked -MIDI Studio by pressing ⌘-2.

The whole script that parses and send notes to the Elektron looks like this.

import pygame.midi
-import time
-
-pygame.midi.init()
-
-print(pygame.midi.get_default_output_id())
-print(pygame.midi.get_device_info(0))
-
-player = pygame.midi.Output(1)
-player.set_instrument(2)
-
-def send_note(note, velocity):
-  global player
-  player.note_on(note, velocity)
-  time.sleep(0.3)
-  player.note_off(note, velocity)
-
-
-nucleotide_midi_map = {
-  'A': 60,
-  'C': 90,
-  'G': 160,
-  'T': 180,  # is D
-}
-
-with open("quote.fa") as f:
-  sequence = f.read().replace('\n', '')
-
-for nucleotide in [char for char in sequence]:
-  print("Playing nucleotide {} with MIDI note {}".format(
-      nucleotide, nucleotide_midi_map[nucleotide]))
-  send_note(nucleotide_midi_map[nucleotide], 127)
-
-del player
-pygame.midi.quit()
-

All of this could be made much more interesting if I choose different -instruments for different Nucleotides, or doing more funky stuff with Elektron. -But for now, this should be enough. It is just a proof of concept. Something to -play around with.

Going even further

As you probably notice, the end results are quite similar to each other. This is -to be expected because we are operating only with 4 notes essentially. What -could make this more interesting is using something like -Supercollider to create more interesting -sounds. By transposing notes or using effects based on repeated data in a -sequence. Possibilities are endless.

It is really astonishing what can be achieved with a little bit of code and an -idea. I could see this becoming an interesting background soundscape instrument -if done properly. It could replace random note generator with something more -intriguing, biological, natural.

I actually find the results fascinating. I took some time and listened to this -music of nature. Even though it's quite the same, it's also quite different. -The subtle differences on repeat kind of creates music on its own. Makes you -wonder. It kind of puts Occam’s Razor in its place. Nature for sure loves to -make things as energy efficient as possible.

\ No newline at end of file -- cgit v1.2.3