Moved to a simpler SSG

1 files changed, 0 insertions, 363 deletions

diff --git a/content/posts/2022-07-05-what-would-dna-sound-if-synthesized.md b/content/posts/2022-07-05-what-would-dna-sound-if-synthesized.md
deleted file mode 100644
index e26088b..0000000
--- a/content/posts/2022-07-05-what-would-dna-sound-if-synthesized.md
+++ /dev/null
@@ -1,363 +0,0 @@
----
-title: What would DNA sound if synthesized to an audio file
-url: what-would-dna-sound-if-synthesized.html
-date: 2022-07-05T12:00:00+02:00
-draft: false
----
-
-## Introduction
-
-Lately, I have been thinking a lot about the nature of life, what are the
-foundation blocks of life and things like that. It's remarkable how complex and
-on the other hand simple the creation is when you look at it. The miracle of
-life keeps us grounded when our imagination goes wild. If the DNA are the blocks
-of life, you could consider them to be an API nature provided us to better
-understand all of this chaos masquerading as order.
-
-I have been reading a lot about superintelligence and our somehow misguided path
-to create general artificial intelligence. What would the building blocks or our
-creation look like? Is the compression really the ultimate storage of
-information? Will our creation also ponder this questions when creating new
-worlds for themselves, or will we just disappear into the vastness of
-possibilities? It is a little offensive that we are playing God whilst being
-completely ignorant of our own reality. Who knows! Like many other
-breakthroughs, this one will also come at a cost not known to us when it finally
-happens.
-
-To keep things a bit lighter, I decided to convert some popular DNA sequences
-into an audio files for us to listen to. I am not the first one, nor I will be
-the last one to do this. But it is an interesting exercise in better
-understanding the relationship between art and science. Maybe listening to DNA
-instead of parsing it will find a way into better understanding, or at least
-enjoying the creation and cryptic nature of life.
-
-## DNA encoding and primer example
-
-I have been exploring DNA in the past in my post from about 3 years ago in
-[Encoding binary data into DNA
-sequence](/encoding-binary-data-into-dna-sequence.html) where I have been
-converting all sorts of data into DNA sequences.
-
-This will be a similar exercise but instead of converting to DNA, I will be
-generating tones from Nucleotides.
-
-| Nucleotides      | Note | Frequency |
-| ---------------- | ---- | --------- |
-| **A** (Adenine)  | A    | 440 Hz    |
-| **C** (Cytosine) | C    | 783.99 Hz |
-| **G** (Guanine)  | G    | 523.25 Hz |
-| **T** (Thymine)  | D    | 587.33 Hz |
-
-Since we do not have T in equal-tempered scale, I choose D to represent T note.
-
-You can check [Frequencies for equal-tempered scale, A4 = 440
-Hz](https://pages.mtu.edu/~suits/notefreqs.html).  For this tuning, we also
-choose `Speed of Sound = 345 m/s = 1130 ft/s = 770 miles/hr`.
-
-Now that we have this out of the way, we can also brush up on the DNA sequencing
-a bit. This is a famous quote I also used for the encoding tests, and it goes
-like this.
-
-> How wonderful that we have met with a paradox. Now we have some hope of
-> making progress.
-> ― Niels Bohr
-
-```shell
->SEQ1
-GACAGCTTGTGTACAAGTGTGCTTGCTCGCGAGCGGGTACGCGCGTGGGCTAACAAGTGA
-GCCAGCAGGTGAACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGCTGGCGGGTGA
-ACAAGTGTGCCGGTGAGCCAACAAGCAGACAAGTAAGCAGGTACGCAGGCGAGCTTGTCA
-ACTCACAAGATCGCTTGTGTACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGTAT
-GCTTGCTGGCGGACAAGCCAGCTTGTAAGCGGACAAGCTTGCGCACAAGCTGGCAGGCCT
-GCCGGCTCGCGTACAAATTCACAAGTAAGTACGCTTGCGTGTACGCGGGTATGTATACTC
-AACCTCACCAAACGGGACAAGATCGCCGGCGGGCTAGTATACAAGAACGCTTGCCAGTAC
-AACC
-```
-
-This is what we gonna work with to get things rolling forward, when creating
-parser and waveform generator.
-
-## Parsing DNA data
-
-This step is rather simple one. All we need to do is parse input DNA sequence in
-[FASTA format](https://en.wikipedia.org/wiki/FASTA_format) well known in
-[Bioinformatics](https://en.wikipedia.org/wiki/Bioinformatics) to extract single
-Nucleotides that will be converted into separate tones based on equal-tempered
-scale explained above.
-
-```python
-nucleotide_tone_map = {
-  'A': 440,
-  'C': 523.25,
-  'G': 783.99,
-  'T': 587.33,  # converted to D
-}
-
-def split(word):
-  return [char for char in word]
-
-def generate_from_dna_sequence(sequence):
-  for nucleotide in split(sequence):
-    print(nucleotide, nucleotide_tone_map[nucleotide])
-```
-
-## Generating sine wave
-
-Because we are essentially creating a long stream of notes we will be appending
-sine notes to a global array we will later use for creating a WAV file out of
-it.
-
-```python
-import math
-
-def append_sinewave(freq=440.0, duration_milliseconds=500, volume=1.0):
-  global audio
-
-  num_samples = duration_milliseconds * (sample_rate / 1000.0)
-
-  for x in range(int(num_samples)):
-    audio.append(volume * math.sin(2 * math.pi * freq * (x / sample_rate)))
-
-  return
-```
-
-The sine wave generated here is the standard beep. If you want something more
-aggressive, you could try a square or saw tooth waveform.
-
-## Generating a WAV file from accumulated sine waves
-
-
-```python
-import wave
-import struct
-
-def save_wav(file_name):
-  wav_file = wave.open(file_name, 'w')
-  nchannels = 1
-  sampwidth = 2
-
-  nframes = len(audio)
-  comptype = 'NONE'
-  compname = 'not compressed'
-  wav_file.setparams((nchannels, sampwidth, sample_rate, nframes, comptype, compname))
-
-  for sample in audio:
-    wav_file.writeframes(struct.pack('h', int(sample * 32767.0)))
-
-  wav_file.close()
-```
-
-44100 is the industry standard sample rate - CD quality.  If you need to save on
-file size, you can adjust it downwards. The standard for low quality is, 8000 or
-8kHz.
-
-WAV files here are using short, 16 bit, signed integers for the sample size.
-So, we multiply the floating-point data we have by 32767, the maximum value for
-a short integer.
-
-> It is theoretically possible to use the floating point -1.0 to 1.0 data 
-> directly in a WAV file, but not obvious how to do that using the wave module 
-> in Python.
-
-## Generating Spectograms
-
-I have tried two methods of doing this and both were just fine. I however opted
-out to use the [SoX - Sound eXchange, the Swiss Army knife of audio
-manipulation](https://linux.die.net/man/1/sox) one because it didn't require
-anything else.
-
-```shell
-sox output.wav -n spectrogram -o spectrogram.png
-```
-
-An example spectrogram of Ludwig van Beethoven Symphony No. 6 First movement.
-
-<audio controls>
-  <source src="/assets/dna-synthesized/symphony-no6-1st-movement.mp3" type="audio/mpeg">
-</audio>
-
-![Ludwig van Beethoven Symphony No. 6 First movement](/assets/dna-synthesized/symphony-no6-1st-movement.png)
-
-The other option could also be in combination with
-[gnuplot](http://www.gnuplot.info/).  This would require an intermediary step,
-however.
-
-```shell
-sox output.wav audio.dat
-tail -n+3 audio.dat > audio_only.dat
-gnuplot audio.gpi
-```
-
-And input file `audio.gpi` that would be passed to gnuplot looks something like
-this.
-
-```
-# set output format and size
-set term png size 1000,280
-
-# set output file
-set output "audio.png"
-
-# set y range
-set yr [-1:1]
-
-# we want just the data
-unset key
-unset tics
-unset border
-set lmargin 0
-set rmargin 0
-set tmargin 0
-set bmargin 0
-
-# draw rectangle to change background color
-set obj 1 rectangle behind from screen 0,0 to screen 1,1
-set obj 1 fillstyle solid 1.0 fillcolor rgbcolor "#ffffff"
-
-# draw data with foreground color
-plot "audio_only.dat" with lines lt rgb 'red'
-```
-
-## Pre-generated sequences
-
-What I did was take interesting parts from an animal's genome and feed it to a
-tone generator script. This then generated a WAV file and I converted those to
-MP3, so they can be played in a browser. The last step was creating a
-spectrogram based on a WAV file.
-
-### Niels Bohr quote
-
-<audio controls>
-  <source src="/assets/dna-synthesized/quote/out.mp3" type="audio/mpeg">
-</audio>
-
-![Spectogram](/assets/dna-synthesized/quote/spectogram.png)
-
-### Mouse
-
-This is part of a mouse genome `Mus_musculus.GRCm39.dna.nonchromosomal`.  You
-can get [genom data
-here](http://ftp.ensembl.org/pub/release-106/fasta/mus_musculus/dna/).
-
-<audio controls>
-  <source src="/assets/dna-synthesized/mouse/out.mp3" type="audio/mpeg">
-</audio>
-
-![Spectogram](/assets/dna-synthesized/mouse/spectogram.png)
-
-### Bison
-
-This is part of a bison genome `Bison_bison_bison.Bison_UMD1.0.cdna`.  You can
-get [genom data
-here](http://ftp.ensembl.org/pub/release-106/fasta/bison_bison_bison/cdna/).
-
-<audio controls>
-  <source src="/assets/dna-synthesized/bison/out.mp3" type="audio/mpeg">
-</audio>
-
-![Spectogram](/assets/dna-synthesized/bison/spectogram.png)
-
-### Taurus
-
-This is part of a taurus genome `Bos_taurus.ARS-UCD1.2.cdna`.  You can get
-[genom data
-here](http://ftp.ensembl.org/pub/release-106/fasta/bos_taurus/cdna/).
-
-<audio controls>
-  <source src="/assets/dna-synthesized/taurus/out.mp3" type="audio/mpeg">
-</audio>
-
-![Spectogram](/assets/dna-synthesized/taurus/spectogram.png)
-
-## Making a drummer out of a DNA sequence
-
-To make things even more interesting, I decided to send this data via MIDI to my
-[Elektron Model:Samples](https://www.elektron.se/en/model-samples). This is a
-really cool piece of equipment that supports MIDI in via USB and 3.5 mm audio
-jack.
-
-Elektron is connected to my MacBook via USB cable and audio out is patched to a
-Sony Bluetooth speaker I have that supports 3.5 mm audio in. Elektron doesn't
-have internal speakers.
-
-![](/assets/dna-synthesized/elektron/IMG_0619.jpg)
-
-![](/assets/dna-synthesized/elektron/IMG_0620.jpg)
-
-![](/assets/dna-synthesized/elektron/IMG_0622.jpg)
-
-For communicating with Elektron, I choose `pygame` Python module that has MIDI
-built in. With this, it was rather simple to send notes to the device. All I did
-was map MIDI notes to the actual Nucleotides.
-
-Before all of this I also checked Audio MIDI Setup app under MacOS and checked
-MIDI Studio by pressing ⌘-2.
-
-![](/assets/dna-synthesized/elektron/midi-studio.jpg)
-
-The whole script that parses and send notes to the Elektron looks like this.
-
-```python
-import pygame.midi
-import time
-
-pygame.midi.init()
-
-print(pygame.midi.get_default_output_id())
-print(pygame.midi.get_device_info(0))
-
-player = pygame.midi.Output(1)
-player.set_instrument(2)
-
-def send_note(note, velocity):
-  global player
-  player.note_on(note, velocity)
-  time.sleep(0.3)
-  player.note_off(note, velocity)
-
-
-nucleotide_midi_map = {
-  'A': 60,
-  'C': 90,
-  'G': 160,
-  'T': 180,  # is D
-}
-
-with open("quote.fa") as f:
-  sequence = f.read().replace('\n', '')
-
-for nucleotide in [char for char in sequence]:
-  print("Playing nucleotide {} with MIDI note {}".format(
-      nucleotide, nucleotide_midi_map[nucleotide]))
-  send_note(nucleotide_midi_map[nucleotide], 127)
-
-del player
-pygame.midi.quit()
-```
-
-<video src="/assets/dna-synthesized/elektron/elektron.mp4" controls></video>
-
-All of this could be made much more interesting if I choose different
-instruments for different Nucleotides, or doing more funky stuff with Elektron.
-But for now, this should be enough. It is just a proof of concept. Something to
-play around with.
-
-## Going even further
-
-As you probably notice, the end results are quite similar to each other. This is
-to be expected because we are operating only with 4 notes essentially. What
-could make this more interesting is using something like
-[Supercollider](https://supercollider.github.io/) to create more interesting
-sounds. By transposing notes or using effects based on repeated data in a
-sequence. Possibilities are endless.
-
-It is really astonishing what can be achieved with a little bit of code and an
-idea. I could see this becoming an interesting background soundscape instrument
-if done properly. It could replace random note generator with something more
-intriguing, biological, natural.
-
-I actually find the results fascinating. I took some time and listened to this
-music of nature. Even though it's quite the same, it's also quite different. 
-The subtle differences on repeat kind of creates music on its own. Makes you
-wonder. It kind of puts Occam’s Razor in its place. Nature for sure loves to
-make things as energy efficient as possible.