1 files changed, 364 insertions, 0 deletions

diff --git a/content/posts/2022-07-05-what-would-dna-sound-if-synthesized.md b/content/posts/2022-07-05-what-would-dna-sound-if-synthesized.md
new file mode 100644
index 0000000..968341c
--- /dev/null
+++ b/content/posts/2022-07-05-what-would-dna-sound-if-synthesized.md
@@ -0,0 +1,364 @@
+---
+title: What would DNA sound if synthesized to an audio file
+url: what-would-dna-sound-if-synthesized.html
+date: 2022-07-05T12:00:00+02:00
+type: post
+draft: false
+---
+
+## Introduction
+
+Lately, I have been thinking a lot about the nature of life, what are the
+foundation blocks of life and things like that. It's remarkable how complex and
+on the other hand simple the creation is when you look at it. The miracle of
+life keeps us grounded when our imagination goes wild. If the DNA are the blocks
+of life, you could consider them to be an API nature provided us to better
+understand all of this chaos masquerading as order.
+
+I have been reading a lot about superintelligence and our somehow misguided path
+to create general artificial intelligence. What would the building blocks or our
+creation look like? Is the compression really the ultimate storage of
+information? Will our creation also ponder this questions when creating new
+worlds for themselves, or will we just disappear into the vastness of
+possibilities? It is a little offensive that we are playing God whilst being
+completely ignorant of our own reality. Who knows! Like many other
+breakthroughs, this one will also come at a cost not known to us when it finally
+happens.
+
+To keep things a bit lighter, I decided to convert some popular DNA sequences
+into an audio files for us to listen to. I am not the first one, nor I will be
+the last one to do this. But it is an interesting exercise in better
+understanding the relationship between art and science. Maybe listening to DNA
+instead of parsing it will find a way into better understanding, or at least
+enjoying the creation and cryptic nature of life.
+
+## DNA encoding and primer example
+
+I have been exploring DNA in the past in my post from about 3 years ago in
+[Encoding binary data into DNA
+sequence](/encoding-binary-data-into-dna-sequence.html) where I have been
+converting all sorts of data into DNA sequences.
+
+This will be a similar exercise but instead of converting to DNA, I will be
+generating tones from Nucleotides.
+
+| Nucleotides      | Note | Frequency |
+| ---------------- | ---- | --------- |
+| **A** (Adenine)  | A    | 440 Hz    |
+| **C** (Cytosine) | C    | 783.99 Hz |
+| **G** (Guanine)  | G    | 523.25 Hz |
+| **T** (Thymine)  | D    | 587.33 Hz |
+
+Since we do not have T in equal-tempered scale, I choose D to represent T note.
+
+You can check [Frequencies for equal-tempered scale, A4 = 440
+Hz](https://pages.mtu.edu/~suits/notefreqs.html).  For this tuning, we also
+choose `Speed of Sound = 345 m/s = 1130 ft/s = 770 miles/hr`.
+
+Now that we have this out of the way, we can also brush up on the DNA sequencing
+a bit. This is a famous quote I also used for the encoding tests, and it goes
+like this.
+
+> How wonderful that we have met with a paradox. Now we have some hope of
+> making progress.
+> ― Niels Bohr
+
+```shell
+>SEQ1
+GACAGCTTGTGTACAAGTGTGCTTGCTCGCGAGCGGGTACGCGCGTGGGCTAACAAGTGA
+GCCAGCAGGTGAACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGCTGGCGGGTGA
+ACAAGTGTGCCGGTGAGCCAACAAGCAGACAAGTAAGCAGGTACGCAGGCGAGCTTGTCA
+ACTCACAAGATCGCTTGTGTACAAGTGTGCGGACAAGCCAGCAGGTGCGCGGACAAGTAT
+GCTTGCTGGCGGACAAGCCAGCTTGTAAGCGGACAAGCTTGCGCACAAGCTGGCAGGCCT
+GCCGGCTCGCGTACAAATTCACAAGTAAGTACGCTTGCGTGTACGCGGGTATGTATACTC
+AACCTCACCAAACGGGACAAGATCGCCGGCGGGCTAGTATACAAGAACGCTTGCCAGTAC
+AACC
+```
+
+This is what we gonna work with to get things rolling forward, when creating
+parser and waveform generator.
+
+## Parsing DNA data
+
+This step is rather simple one. All we need to do is parse input DNA sequence in
+[FASTA format](https://en.wikipedia.org/wiki/FASTA_format) well known in
+[Bioinformatics](https://en.wikipedia.org/wiki/Bioinformatics) to extract single
+Nucleotides that will be converted into separate tones based on equal-tempered
+scale explained above.
+
+```python
+nucleotide_tone_map = {
+  'A': 440,
+  'C': 523.25,
+  'G': 783.99,
+  'T': 587.33,  # converted to D
+}
+
+def split(word):
+  return [char for char in word]
+
+def generate_from_dna_sequence(sequence):
+  for nucleotide in split(sequence):
+    print(nucleotide, nucleotide_tone_map[nucleotide])
+```
+
+## Generating sine wave
+
+Because we are essentially creating a long stream of notes we will be appending
+sine notes to a global array we will later use for creating a WAV file out of
+it.
+
+```python
+import math
+
+def append_sinewave(freq=440.0, duration_milliseconds=500, volume=1.0):
+  global audio
+
+  num_samples = duration_milliseconds * (sample_rate / 1000.0)
+
+  for x in range(int(num_samples)):
+    audio.append(volume * math.sin(2 * math.pi * freq * (x / sample_rate)))
+
+  return
+```
+
+The sine wave generated here is the standard beep. If you want something more
+aggressive, you could try a square or saw tooth waveform.
+
+## Generating a WAV file from accumulated sine waves
+
+
+```python
+import wave
+import struct
+
+def save_wav(file_name):
+  wav_file = wave.open(file_name, 'w')
+  nchannels = 1
+  sampwidth = 2
+
+  nframes = len(audio)
+  comptype = 'NONE'
+  compname = 'not compressed'
+  wav_file.setparams((nchannels, sampwidth, sample_rate, nframes, comptype, compname))
+
+  for sample in audio:
+    wav_file.writeframes(struct.pack('h', int(sample * 32767.0)))
+
+  wav_file.close()
+```
+
+44100 is the industry standard sample rate - CD quality.  If you need to save on
+file size, you can adjust it downwards. The standard for low quality is, 8000 or
+8kHz.
+
+WAV files here are using short, 16 bit, signed integers for the sample size.
+So, we multiply the floating-point data we have by 32767, the maximum value for
+a short integer.
+
+> It is theoretically possible to use the floating point -1.0 to 1.0 data 
+> directly in a WAV file, but not obvious how to do that using the wave module 
+> in Python.
+
+## Generating Spectograms
+
+I have tried two methods of doing this and both were just fine. I however opted
+out to use the [SoX - Sound eXchange, the Swiss Army knife of audio
+manipulation](https://linux.die.net/man/1/sox) one because it didn't require
+anything else.
+
+```shell
+sox output.wav -n spectrogram -o spectrogram.png
+```
+
+An example spectrogram of Ludwig van Beethoven Symphony No. 6 First movement.
+
+<audio controls>
+  <source src="/assets/dna-synthesized/symphony-no6-1st-movement.mp3" type="audio/mpeg">
+</audio>
+
+![Ludwig van Beethoven Symphony No. 6 First movement](/assets/dna-synthesized/symphony-no6-1st-movement.png)
+
+The other option could also be in combination with
+[gnuplot](http://www.gnuplot.info/).  This would require an intermediary step,
+however.
+
+```shell
+sox output.wav audio.dat
+tail -n+3 audio.dat > audio_only.dat
+gnuplot audio.gpi
+```
+
+And input file `audio.gpi` that would be passed to gnuplot looks something like
+this.
+
+```
+# set output format and size
+set term png size 1000,280
+
+# set output file
+set output "audio.png"
+
+# set y range
+set yr [-1:1]
+
+# we want just the data
+unset key
+unset tics
+unset border
+set lmargin 0
+set rmargin 0
+set tmargin 0
+set bmargin 0
+
+# draw rectangle to change background color
+set obj 1 rectangle behind from screen 0,0 to screen 1,1
+set obj 1 fillstyle solid 1.0 fillcolor rgbcolor "#ffffff"
+
+# draw data with foreground color
+plot "audio_only.dat" with lines lt rgb 'red'
+```
+
+## Pre-generated sequences
+
+What I did was take interesting parts from an animal's genome and feed it to a
+tone generator script. This then generated a WAV file and I converted those to
+MP3, so they can be played in a browser. The last step was creating a
+spectrogram based on a WAV file.
+
+### Niels Bohr quote
+
+<audio controls>
+  <source src="/assets/dna-synthesized/quote/out.mp3" type="audio/mpeg">
+</audio>
+
+![Spectogram](/assets/dna-synthesized/quote/spectogram.png)
+
+### Mouse
+
+This is part of a mouse genome `Mus_musculus.GRCm39.dna.nonchromosomal`.  You
+can get [genom data
+here](http://ftp.ensembl.org/pub/release-106/fasta/mus_musculus/dna/).
+
+<audio controls>
+  <source src="/assets/dna-synthesized/mouse/out.mp3" type="audio/mpeg">
+</audio>
+
+![Spectogram](/assets/dna-synthesized/mouse/spectogram.png)
+
+### Bison
+
+This is part of a bison genome `Bison_bison_bison.Bison_UMD1.0.cdna`.  You can
+get [genom data
+here](http://ftp.ensembl.org/pub/release-106/fasta/bison_bison_bison/cdna/).
+
+<audio controls>
+  <source src="/assets/dna-synthesized/bison/out.mp3" type="audio/mpeg">
+</audio>
+
+![Spectogram](/assets/dna-synthesized/bison/spectogram.png)
+
+### Taurus
+
+This is part of a taurus genome `Bos_taurus.ARS-UCD1.2.cdna`.  You can get
+[genom data
+here](http://ftp.ensembl.org/pub/release-106/fasta/bos_taurus/cdna/).
+
+<audio controls>
+  <source src="/assets/dna-synthesized/taurus/out.mp3" type="audio/mpeg">
+</audio>
+
+![Spectogram](/assets/dna-synthesized/taurus/spectogram.png)
+
+## Making a drummer out of a DNA sequence
+
+To make things even more interesting, I decided to send this data via MIDI to my
+[Elektron Model:Samples](https://www.elektron.se/en/model-samples). This is a
+really cool piece of equipment that supports MIDI in via USB and 3.5 mm audio
+jack.
+
+Elektron is connected to my MacBook via USB cable and audio out is patched to a
+Sony Bluetooth speaker I have that supports 3.5 mm audio in. Elektron doesn't
+have internal speakers.
+
+![](/assets/dna-synthesized/elektron/IMG_0619.jpg)
+
+![](/assets/dna-synthesized/elektron/IMG_0620.jpg)
+
+![](/assets/dna-synthesized/elektron/IMG_0622.jpg)
+
+For communicating with Elektron, I choose `pygame` Python module that has MIDI
+built in. With this, it was rather simple to send notes to the device. All I did
+was map MIDI notes to the actual Nucleotides.
+
+Before all of this I also checked Audio MIDI Setup app under MacOS and checked
+MIDI Studio by pressing ⌘-2.
+
+![](/assets/dna-synthesized/elektron/midi-studio.jpg)
+
+The whole script that parses and send notes to the Elektron looks like this.
+
+```python
+import pygame.midi
+import time
+
+pygame.midi.init()
+
+print(pygame.midi.get_default_output_id())
+print(pygame.midi.get_device_info(0))
+
+player = pygame.midi.Output(1)
+player.set_instrument(2)
+
+def send_note(note, velocity):
+  global player
+  player.note_on(note, velocity)
+  time.sleep(0.3)
+  player.note_off(note, velocity)
+
+
+nucleotide_midi_map = {
+  'A': 60,
+  'C': 90,
+  'G': 160,
+  'T': 180,  # is D
+}
+
+with open("quote.fa") as f:
+  sequence = f.read().replace('\n', '')
+
+for nucleotide in [char for char in sequence]:
+  print("Playing nucleotide {} with MIDI note {}".format(
+      nucleotide, nucleotide_midi_map[nucleotide]))
+  send_note(nucleotide_midi_map[nucleotide], 127)
+
+del player
+pygame.midi.quit()
+```
+
+<video src="/assets/dna-synthesized/elektron/elektron.mp4" controls></video>
+
+All of this could be made much more interesting if I choose different
+instruments for different Nucleotides, or doing more funky stuff with Elektron.
+But for now, this should be enough. It is just a proof of concept. Something to
+play around with.
+
+## Going even further
+
+As you probably notice, the end results are quite similar to each other. This is
+to be expected because we are operating only with 4 notes essentially. What
+could make this more interesting is using something like
+[Supercollider](https://supercollider.github.io/) to create more interesting
+sounds. By transposing notes or using effects based on repeated data in a
+sequence. Possibilities are endless.
+
+It is really astonishing what can be achieved with a little bit of code and an
+idea. I could see this becoming an interesting background soundscape instrument
+if done properly. It could replace random note generator with something more
+intriguing, biological, natural.
+
+I actually find the results fascinating. I took some time and listened to this
+music of nature. Even though it's quite the same, it's also quite different. 
+The subtle differences on repeat kind of creates music on its own. Makes you
+wonder. It kind of puts Occam’s Razor in its place. Nature for sure loves to
+make things as energy efficient as possible.